NSFL1C cDNA ORF Clone, Human, untagged

Cat: HG16229-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NSFL1C Reagents
CRO Services
Product recommended

All NSFL1C Reagents
NSFL1C cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1113 bp
Description
Full length Clone DNA of Human NSFL1 (p97) cofactor (p47).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NSFL1C cDNA ORF Clone, Human, untagged Alternative Names
dJ776F14.1 cDNA ORF Clone, Human;P47 cDNA ORF Clone, Human;UBX1 cDNA ORF Clone, Human;UBXD10 cDNA ORF Clone, Human;UBXN2C cDNA ORF Clone, Human
NSFL1C Background Information
Full Name
NSFL1 (p97) cofactor (p47)

NSFL1C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NSFL1C cDNA ORF Clone in Cloning Vector, Rat RG81477-G

NSFL1C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NSFL1C cDNA ORF Clone in Cloning Vector, Mouse MG52952-G
NSFL1C cDNA ORF Clone, Mouse, untagged MG52952-UT
NSFL1C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52952-ACG
NSFL1C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52952-ACGLN
NSFL1C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52952-ANG
NSFL1C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52952-ACR
NSFL1C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52952-ANR
NSFL1C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52952-CF
NSFL1C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52952-NF
NSFL1C cDNA ORF Clone, Mouse, C-His tag MG52952-CH
NSFL1C cDNA ORF Clone, Mouse, N-His tag MG52952-NH
NSFL1C cDNA ORF Clone, Mouse, C-HA tag MG52952-CY
NSFL1C cDNA ORF Clone, Mouse, N-HA tag MG52952-NY
NSFL1C cDNA ORF Clone, Mouse, C-Myc tag MG52952-CM
NSFL1C cDNA ORF Clone, Mouse, N-Myc tag MG52952-NM

NSFL1C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NSFL1C cDNA ORF Clone in Cloning Vector, Human HG16229-G
NSFL1C cDNA ORF Clone, Human, C-GFPSpark® tag HG16229-ACG
NSFL1C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16229-ACGLN
NSFL1C cDNA ORF Clone, Human, N-GFPSpark® tag HG16229-ANG
NSFL1C cDNA ORF Clone, Human, C-OFPSpark® tag HG16229-ACR
NSFL1C cDNA ORF Clone, Human, N-OFPSpark® tag HG16229-ANR
NSFL1C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16229-CF
NSFL1C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16229-NF
NSFL1C cDNA ORF Clone, Human, C-His tag HG16229-CH
NSFL1C cDNA ORF Clone, Human, N-His tag HG16229-NH
NSFL1C cDNA ORF Clone, Human, C-HA tag HG16229-CY
NSFL1C cDNA ORF Clone, Human, N-HA tag HG16229-NY
NSFL1C cDNA ORF Clone, Human, C-Myc tag HG16229-CM
NSFL1C cDNA ORF Clone, Human, N-Myc tag HG16229-NM
NSFL1C qPCR Primer Pairs, Human HP104994
info info
添加购物车成功! 添加购物车失败!