Quick Order

Human NR3C1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human NR3C1 cDNA Clone Product Information
NCBI RefSeq:NM_000176.2
RefSeq ORF Size:2334bp
cDNA Description:Full length Clone DNA of Homo sapiens nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor).
Gene Synonym:GR, GCR, GRL, GCCR, NR3C1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NR3C1
Restriction Site:KpnI + XbaI (6.1kb + 2.33kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 1566 T/C and 2298 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human NR3C1 Gene Plasmid Map
Human NR3C1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG12044-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human NR3C1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"