NR1I3 cDNA ORF Clone, Human, N-His tag

Cat: HG13077-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NR1I3 Reagents
CRO Services
Product recommended

All NR1I3 Reagents
NR1I3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Human nuclear receptor subfamily 1, group I, member 3, transcript variant 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NR1I3 cDNA ORF Clone, Human, N-His tag Alternative Names
CAR cDNA ORF Clone, Human;CAR1 cDNA ORF Clone, Human;MB67 cDNA ORF Clone, Human
NR1I3 Background Information
Full Name
nuclear receptor subfamily 1, group I, member 3

NR1I3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NR1I3 cDNA ORF Clone in Cloning Vector, Mouse MG53300-U
NR1I3 cDNA ORF Clone, Mouse, untagged MG53300-UT
NR1I3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53300-ACGLN
NR1I3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53300-ACG
NR1I3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53300-ANG
NR1I3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53300-ACR
NR1I3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53300-ANR
NR1I3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53300-CF
NR1I3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53300-NF
NR1I3 cDNA ORF Clone, Mouse, C-His tag MG53300-CH
NR1I3 cDNA ORF Clone, Mouse, N-His tag MG53300-NH
NR1I3 cDNA ORF Clone, Mouse, C-HA tag MG53300-CY
NR1I3 cDNA ORF Clone, Mouse, N-HA tag MG53300-NY
NR1I3 cDNA ORF Clone, Mouse, C-Myc tag MG53300-CM
NR1I3 cDNA ORF Clone, Mouse, N-Myc tag MG53300-NM

NR1I3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NR1I3 cDNA ORF Clone in Cloning Vector, Human HG13077-G
NR1I3 cDNA ORF Clone, Human, untagged HG13077-UT
NR1I3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13077-ACGLN
NR1I3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13077-ACG
NR1I3 cDNA ORF Clone, Human, N-GFPSpark® tag HG13077-ANG
NR1I3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13077-ACR
NR1I3 cDNA ORF Clone, Human, N-OFPSpark® tag HG13077-ANR
NR1I3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13077-CF
NR1I3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13077-NF
NR1I3 cDNA ORF Clone, Human, C-His tag HG13077-CH
NR1I3 cDNA ORF Clone, Human, C-HA tag HG13077-CY
NR1I3 cDNA ORF Clone, Human, N-HA tag HG13077-NY
NR1I3 cDNA ORF Clone, Human, C-Myc tag HG13077-CM
NR1I3 cDNA ORF Clone, Human, N-Myc tag HG13077-NM
NR1I3 qPCR Primer Pairs, Human HP101695
info info
添加购物车成功! 添加购物车失败!