NQO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14634-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NQO2 Reagents
CRO Services
Product recommended

All NQO2 Reagents
NQO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
696 bp
Description
Full length Clone DNA of Human NAD(P)H dehydrogenase, quinone 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NQO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
DHQV cDNA ORF Clone, Human;DIA6 cDNA ORF Clone, Human;NMOR2 cDNA ORF Clone, Human;QR2 cDNA ORF Clone, Human
NQO2 Background Information
Full Name
NAD(P)H dehydrogenase, quinone 2

NQO2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NQO2 cDNA ORF Clone in Cloning Vector, Mouse MG59659-U
NQO2 cDNA ORF Clone, Mouse, untagged MG59659-UT
NQO2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59659-ACG
NQO2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59659-ACGLN
NQO2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59659-ANG
NQO2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59659-ACR
NQO2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59659-ANR
NQO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59659-CF
NQO2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59659-NF
NQO2 cDNA ORF Clone, Mouse, C-His tag MG59659-CH
NQO2 cDNA ORF Clone, Mouse, N-His tag MG59659-NH
NQO2 cDNA ORF Clone, Mouse, C-HA tag MG59659-CY
NQO2 cDNA ORF Clone, Mouse, N-HA tag MG59659-NY
NQO2 cDNA ORF Clone, Mouse, C-Myc tag MG59659-CM
NQO2 cDNA ORF Clone, Mouse, N-Myc tag MG59659-NM

NQO2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NQO2 cDNA ORF Clone in Cloning Vector, Human HG14634-G
NQO2 cDNA ORF Clone, Human, untagged HG14634-UT
NQO2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14634-ACGLN
NQO2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14634-ACG
NQO2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14634-ANG
NQO2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14634-ACR
NQO2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14634-ANR
NQO2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14634-CF
NQO2 cDNA ORF Clone, Human, C-His tag HG14634-CH
NQO2 cDNA ORF Clone, Human, N-His tag HG14634-NH
NQO2 cDNA ORF Clone, Human, C-HA tag HG14634-CY
NQO2 cDNA ORF Clone, Human, N-HA tag HG14634-NY
NQO2 cDNA ORF Clone, Human, C-Myc tag HG14634-CM
NQO2 cDNA ORF Clone, Human, N-Myc tag HG14634-NM
NQO2 qPCR Primer Pairs, Human HP103268
info info
添加购物车成功! 添加购物车失败!