Quick Order

Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human NPM1 cDNA Clone Product Information
NCBI RefSeq:NM_002520
RefSeq ORF Size:885bp
cDNA Description:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin).
Gene Synonym:B23, NPM
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NPM1
Restriction Site:KpnI + XbaI (6.1kb + 0.89kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human NPM1 Gene Plasmid Map
Human NPM1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid on other vectors
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG12074-ACG$225
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG12074-ACR$225
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG12074-ANG$225
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG12074-ANR$225
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG12074-CF$195
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG12074-CH$195
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG12074-CM$195
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG12074-CY$195
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone in cloning vectorHG12074-G$75
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG12074-NF$195
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG12074-NH$195
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG12074-NM$195
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG12074-NY$195
Human NPM1/Nucleophosmin transcript variant 1 Gene ORF cDNA clone expression plasmidHG12074-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

References
  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Catalog: HG12074-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human NPM1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"