Noggin cDNA ORF Clone, Human, N-His tag

Cat: HG10267-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Noggin Reagents
CRO Services
Product recommended

All Noggin Reagents
Noggin cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
699 bp
Description
Full length Clone DNA of Human noggin with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Noggin cDNA ORF Clone, Human, N-His tag Alternative Names
Noggin cDNA ORF Clone, Human;SYM1 cDNA ORF Clone, Human;SYNS1 cDNA ORF Clone, Human
Noggin Background Information

Noggin is a secreted protein involved at multiple stages of vertebrate embryonic development including neural induction and is known to exert its effects by inhibiting the bone morphogenetic protein (BMP)-signaling pathway. It binds several BMPs with very high (picomolar) affinities, with a marked preference for BMP2 and BMP4 over BMP7. By binding tightly to BMPs, Noggin prevents BMPs from binding their receptors. Noggin binds the bone morphogenetic proteins (BMP) such as BMP-4 and BMP-7, and inhibits BMP signaling by blocking the molecular interfaces of the binding epitopes for both type I and type II receptors. Interaction of BMP and its antagonist Noggin governs various developmental and cellular processes, including embryonic dorsal-ventral axis, induction of neural tissue, formation of joints in the skeletal system and neurogenesis in the adult brain. Noggin plays a key role in neural induction by inhibiting BMP4, along with other TGF-β signaling inhibitors such as chordin and follistatin. Mouse knockout experiments have demonstrated that noggin also plays a crucial role in bone development, joint formation, and neural tube fusion.

Full Name
noggin
References
  • Zimmerman LB, et al. (1996) The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell. 86(4): 599-606.
  • Chandramore K, et al. (2010) Cloning of noggin gene from hydra and analysis of its functional conservation using Xenopus laevis embryos. Evol Dev. 12(3): 267-74.
  • Noggin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Noggin cDNA ORF Clone, Rat, untagged RG83345-UT
    Noggin cDNA ORF Clone, Rat, C-GFPSpark® tag RG83345-ACG
    Noggin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83345-ACGLN
    Noggin cDNA ORF Clone, Rat, C-OFPSpark® tag RG83345-ACR
    Noggin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG83345-CF
    Noggin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG83345-NF
    Noggin cDNA ORF Clone, Rat, C-His tag RG83345-CH
    Noggin cDNA ORF Clone, Rat, N-His tag RG83345-NH
    Noggin cDNA ORF Clone, Rat, C-HA tag RG83345-CY
    Noggin cDNA ORF Clone, Rat, N-HA tag RG83345-NY
    Noggin cDNA ORF Clone, Rat, C-Myc tag RG83345-CM
    Noggin cDNA ORF Clone, Rat, N-Myc tag RG83345-NM

    Noggin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Noggin cDNA ORF Clone in Cloning Vector, Mouse MG50688-G
    Noggin cDNA ORF Clone, Mouse, untagged MG50688-UT
    Noggin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50688-ACG
    Noggin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50688-ACGLN
    Noggin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50688-ACR
    Noggin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50688-CF
    Noggin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50688-NF
    Noggin cDNA ORF Clone, Mouse, C-His tag MG50688-CH
    Noggin cDNA ORF Clone, Mouse, N-His tag MG50688-NH
    Noggin cDNA ORF Clone, Mouse, C-HA tag MG50688-CY
    Noggin cDNA ORF Clone, Mouse, N-HA tag MG50688-NY
    Noggin cDNA ORF Clone, Mouse, C-Myc tag MG50688-CM
    Noggin cDNA ORF Clone, Mouse, N-Myc tag MG50688-NM
    Noggin qPCR Primer Pairs, Mouse MP200665

    Noggin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Noggin cDNA ORF Clone in Cloning Vector, Human HG10267-M
    Noggin cDNA ORF Clone, Human, untagged HG10267-UT
    Noggin cDNA ORF Clone, Human, C-GFPSpark® tag HG10267-ACG
    Noggin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10267-ACGLN
    Noggin cDNA ORF Clone, Human, C-OFPSpark® tag HG10267-ACR
    Noggin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10267-CF
    Noggin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10267-NF
    Noggin cDNA ORF Clone, Human, C-His tag HG10267-CH
    Noggin cDNA ORF Clone, Human, C-HA tag HG10267-CY
    Noggin cDNA ORF Clone, Human, N-HA tag HG10267-NY
    Noggin cDNA ORF Clone, Human, C-Myc tag HG10267-CM
    Noggin cDNA ORF Clone, Human, N-Myc tag HG10267-NM
    Noggin qPCR Primer Pairs, Human HP100315
    info info
    添加购物车成功! 添加购物车失败!