NOB1/NOB1P cDNA ORF Clone, Human, C-HA tag

Cat: HG16424-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NOB1/NOB1P Reagents
CRO Services
Product recommended

All NOB1/NOB1P Reagents
NOB1/NOB1P cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Human NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NOB1/NOB1P cDNA ORF Clone, Human, C-HA tag Alternative Names
ART-4 cDNA ORF Clone, Human;MST158 cDNA ORF Clone, Human;MSTP158 cDNA ORF Clone, Human;NOB1P cDNA ORF Clone, Human;PSMD8BP1 cDNA ORF Clone, Human
NOB1/NOB1P Background Information
Full Name
NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)

NOB1/NOB1P cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NOB1/NOB1P cDNA ORF Clone in Cloning Vector, Rat RG80899-U
NOB1/NOB1P cDNA ORF Clone, Rat, untagged RG80899-UT
NOB1/NOB1P Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80899-ACGLN
NOB1/NOB1P cDNA ORF Clone, Rat, C-GFPSpark® tag RG80899-ACG
NOB1/NOB1P cDNA ORF Clone, Rat, N-GFPSpark® tag RG80899-ANG
NOB1/NOB1P cDNA ORF Clone, Rat, C-OFPSpark® tag RG80899-ACR
NOB1/NOB1P cDNA ORF Clone, Rat, N-OFPSpark® tag RG80899-ANR
NOB1/NOB1P cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80899-CF
NOB1/NOB1P cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80899-NF
NOB1/NOB1P cDNA ORF Clone, Rat, C-His tag RG80899-CH
NOB1/NOB1P cDNA ORF Clone, Rat, N-His tag RG80899-NH
NOB1/NOB1P cDNA ORF Clone, Rat, C-HA tag RG80899-CY
NOB1/NOB1P cDNA ORF Clone, Rat, N-HA tag RG80899-NY
NOB1/NOB1P cDNA ORF Clone, Rat, C-Myc tag RG80899-CM
NOB1/NOB1P cDNA ORF Clone, Rat, N-Myc tag RG80899-NM
NOB1/NOB1P qPCR Primer Pairs, Rat RP300863

NOB1/NOB1P cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NOB1/NOB1P cDNA ORF Clone in Cloning Vector, Human HG16424-U
NOB1/NOB1P cDNA ORF Clone, Human, untagged HG16424-UT
NOB1/NOB1P Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16424-ACGLN
NOB1/NOB1P cDNA ORF Clone, Human, C-GFPSpark® tag HG16424-ACG
NOB1/NOB1P cDNA ORF Clone, Human, N-GFPSpark® tag HG16424-ANG
NOB1/NOB1P cDNA ORF Clone, Human, C-OFPSpark® tag HG16424-ACR
NOB1/NOB1P cDNA ORF Clone, Human, N-OFPSpark® tag HG16424-ANR
NOB1/NOB1P cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16424-CF
NOB1/NOB1P cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16424-NF
NOB1/NOB1P cDNA ORF Clone, Human, C-His tag HG16424-CH
NOB1/NOB1P cDNA ORF Clone, Human, N-His tag HG16424-NH
NOB1/NOB1P cDNA ORF Clone, Human, N-HA tag HG16424-NY
NOB1/NOB1P cDNA ORF Clone, Human, C-Myc tag HG16424-CM
NOB1/NOB1P cDNA ORF Clone, Human, N-Myc tag HG16424-NM
NOB1/NOB1P qPCR Primer Pairs, Human HP105173
info info
添加购物车成功! 添加购物车失败!