NMNAT1 cDNA ORF Clone, Human, N-His tag

Cat: HG11448-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NMNAT1 Reagents
CRO Services
Product recommended

All NMNAT1 Reagents
NMNAT1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
840 bp
Description
Full length Clone DNA of Human nicotinamide nucleotide adenylyltransferase 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NMNAT1 cDNA ORF Clone, Human, N-His tag Alternative Names
LCA9 cDNA ORF Clone, Human;NMNAT cDNA ORF Clone, Human;PNAT1 cDNA ORF Clone, Human
NMNAT1 Background Information

NMNAT, also known as NMNAT1, is a member of the Nicotinamide-nucleotide adenylyltransferases. It is widely expressed with high levels in skeletal muscle, heart, liver and kidney. NMNAT appears to have the ability to protect against axonal degeneration following mechanical or toxic insults. The coenzyme NAD and its derivatives are involved in hundreds of metabolic redox reactions and are utilized in protein ADP-ribosylation, histone deacetylation, and in some Ca(2+) signaling pathways. NMNAT enzyme is vital for NAD biosynthesis, catalyzing the condensation of nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) with the AMP moiety of ATP to form NAD or NaAD.

Full Name
nicotinamide nucleotide adenylyltransferase 1
References
  • Sugano S. et al., 1994, Gene. 138 (1-2): 171-4.
  • Saccucci F. et al., 2001, J Biol Chem. 276 (1): 406-12.
  • Hennig K. et al., 2001, FEBS Lett. 492 (1-2): 95-100.
  • NMNAT1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NMNAT1 cDNA ORF Clone, Mouse, untagged MG59238-UT
    NMNAT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59238-ACGLN
    NMNAT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59238-ACG
    NMNAT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59238-ANG
    NMNAT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59238-ACR
    NMNAT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59238-ANR
    NMNAT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59238-CF
    NMNAT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59238-NF
    NMNAT1 cDNA ORF Clone, Mouse, C-His tag MG59238-CH
    NMNAT1 cDNA ORF Clone, Mouse, N-His tag MG59238-NH
    NMNAT1 cDNA ORF Clone, Mouse, C-HA tag MG59238-CY
    NMNAT1 cDNA ORF Clone, Mouse, N-HA tag MG59238-NY
    NMNAT1 cDNA ORF Clone, Mouse, C-Myc tag MG59238-CM
    NMNAT1 cDNA ORF Clone, Mouse, N-Myc tag MG59238-NM

    NMNAT1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NMNAT1 cDNA ORF Clone in Cloning Vector, Human HG11448-M
    NMNAT1 cDNA ORF Clone, Human, untagged HG11448-UT
    NMNAT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11448-ACG
    NMNAT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11448-ACGLN
    NMNAT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11448-ANG
    NMNAT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11448-ACR
    NMNAT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11448-ANR
    NMNAT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11448-CF
    NMNAT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11448-NF
    NMNAT1 cDNA ORF Clone, Human, C-His tag HG11448-CH
    NMNAT1 cDNA ORF Clone, Human, C-HA tag HG11448-CY
    NMNAT1 cDNA ORF Clone, Human, N-HA tag HG11448-NY
    NMNAT1 cDNA ORF Clone, Human, C-Myc tag HG11448-CM
    NMNAT1 cDNA ORF Clone, Human, N-Myc tag HG11448-NM
    NMNAT1 qPCR Primer Pairs, Human HP101325
    info info
    添加购物车成功! 添加购物车失败!