NLK cDNA ORF Clone, Human, N-Myc tag

Cat: HG11573-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NLK Reagents
CRO Services
Product recommended

All NLK Reagents
NLK cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1584 bp
Description
Full length Clone DNA of Human nemo-like kinase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NLK Background Information

Nemo-like kinase contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MAP kinase subfamily. It also contains a TQE activation loop motif in which autophosphorylation of the threonine residue (Thr-298) is sufficient for kinase activation. As a serine/threonine-protein kinase, nemo-like kinase regulates a number of transcription factors with key roles in cell fate determination. It is a positive effector of the non-canonical Wnt signaling pathway, acting downstream of WNT5A, MAP3K7/TAK1 and HIPK2. Activation of this pathway causes binding to and phosphorylation of the histone methyltransferase SETDB1. The NLK-SETDB1 complex subsequently interacts with PPARG, leading to methylation of PPARG target promoters at histone H3K9 and transcriptional silencing. The resulting loss of PPARG target gene transcription inhibits adipogenesis and promotes osteoblastogenesis in mesenchymal stem cells (MSCs). Nemo-like kinase also is a negative regulator of the canonical Wnt/beta-catenin signaling pathway.

Full Name
nemo-like kinase
References
  • Smit L, et al. (2004) Wnt activates the Tak1/Nemo-like kinase pathway. J Biol Chem. 279(17): 17232-40.
  • Yasuda J, et al. (2004) Nemo-like kinase suppresses a wide range of transcription factors, including nuclear factor-kappaB. Cancer Sci. 95(1):52-7.
  • Yasuda J, et al. (2003) Nemo-like kinase induces apoptosis in DLD-1 human colon cancer cells. Biochem Biophys Res Commun. 308(2):227-335.
  • Ishitani T, et al. (2003) Regulation of lymphoid enhancer factor 1/T-cell factor by mitogen-activated protein kinase-related Nemo-like kinase-dependent phosphorylation in Wnt/beta-catenin signaling. Mol Cell Biol. 23(4):1379-89.
  • info info
    添加购物车成功! 添加购物车失败!