NLE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16361-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NLE1 Reagents
CRO Services
Product recommended

All NLE1 Reagents
NLE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
582 bp
Description
Full length Clone DNA of Human notchless homolog 1 (Drosophila) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NLE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
Nle cDNA ORF Clone, Human
NLE1 Background Information
Full Name
notchless homolog 1 (Drosophila)
Research Areas

NLE1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NLE1 cDNA ORF Clone in Cloning Vector, Mouse MG52502-G
NLE1 cDNA ORF Clone, Mouse, untagged MG52502-UT
NLE1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52502-ACGLN
NLE1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52502-ACG
NLE1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52502-ANG
NLE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52502-ACR
NLE1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52502-ANR
NLE1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52502-CF
NLE1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52502-NF
NLE1 cDNA ORF Clone, Mouse, C-His tag MG52502-CH
NLE1 cDNA ORF Clone, Mouse, N-His tag MG52502-NH
NLE1 cDNA ORF Clone, Mouse, C-HA tag MG52502-CY
NLE1 cDNA ORF Clone, Mouse, N-HA tag MG52502-NY
NLE1 cDNA ORF Clone, Mouse, C-Myc tag MG52502-CM
NLE1 cDNA ORF Clone, Mouse, N-Myc tag MG52502-NM
NLE1 qPCR Primer Pairs, Mouse MP202375

NLE1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NLE1 cDNA ORF Clone in Cloning Vector, Human HG16361-G
NLE1 cDNA ORF Clone, Human, untagged HG16361-UT
NLE1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16361-ACGLN
NLE1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16361-ACG
NLE1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16361-ANG
NLE1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16361-ACR
NLE1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16361-ANR
NLE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16361-CF
NLE1 cDNA ORF Clone, Human, C-His tag HG16361-CH
NLE1 cDNA ORF Clone, Human, N-His tag HG16361-NH
NLE1 cDNA ORF Clone, Human, C-HA tag HG16361-CY
NLE1 cDNA ORF Clone, Human, N-HA tag HG16361-NY
NLE1 cDNA ORF Clone, Human, C-Myc tag HG16361-CM
NLE1 cDNA ORF Clone, Human, N-Myc tag HG16361-NM
NLE1 qPCR Primer Pairs, Human HP105112
info info
添加购物车成功! 添加购物车失败!