NGFRAP1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16216-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NGFRAP1 Reagents
CRO Services
Product recommended

All NGFRAP1 Reagents
NGFRAP1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
306 bp
Description
Full length Clone DNA of Human nerve growth factor receptor (TNFRSF16) associated protein 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NGFRAP1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
Bex cDNA ORF Clone, Human;BEX3 cDNA ORF Clone, Human;DXS6984E cDNA ORF Clone, Human;HGR74 cDNA ORF Clone, Human;NADE cDNA ORF Clone, Human
NGFRAP1 Background Information
Full Name
nerve growth factor receptor (TNFRSF16) associated protein 1

NGFRAP1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
NGFRAP1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90674-G
NGFRAP1 cDNA ORF Clone, Cynomolgus, untagged CG90674-UT
NGFRAP1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90674-ACGLN
NGFRAP1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90674-ACG
NGFRAP1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90674-ANG
NGFRAP1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90674-ACR
NGFRAP1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90674-ANR
NGFRAP1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90674-CF
NGFRAP1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90674-NF
NGFRAP1 cDNA ORF Clone, Cynomolgus, C-His tag CG90674-CH
NGFRAP1 cDNA ORF Clone, Cynomolgus, N-His tag CG90674-NH
NGFRAP1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90674-CY
NGFRAP1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90674-NY
NGFRAP1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90674-CM
NGFRAP1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90674-NM

NGFRAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NGFRAP1 cDNA ORF Clone in Cloning Vector, Mouse MG53497-G
NGFRAP1 cDNA ORF Clone, Mouse, untagged MG53497-UT
NGFRAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53497-ACGLN
NGFRAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53497-ACG
NGFRAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53497-ANG
NGFRAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53497-ACR
NGFRAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53497-ANR
NGFRAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53497-CF
NGFRAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53497-NF
NGFRAP1 cDNA ORF Clone, Mouse, C-His tag MG53497-CH
NGFRAP1 cDNA ORF Clone, Mouse, N-His tag MG53497-NH
NGFRAP1 cDNA ORF Clone, Mouse, C-HA tag MG53497-CY
NGFRAP1 cDNA ORF Clone, Mouse, N-HA tag MG53497-NY
NGFRAP1 cDNA ORF Clone, Mouse, C-Myc tag MG53497-CM
NGFRAP1 cDNA ORF Clone, Mouse, N-Myc tag MG53497-NM

NGFRAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NGFRAP1 cDNA ORF Clone in Cloning Vector, Human HG16216-G
NGFRAP1 cDNA ORF Clone, Human, untagged HG16216-UT
NGFRAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16216-ACG
NGFRAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16216-ACGLN
NGFRAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16216-ANG
NGFRAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16216-ACR
NGFRAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16216-ANR
NGFRAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16216-CF
NGFRAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16216-NF
NGFRAP1 cDNA ORF Clone, Human, C-His tag HG16216-CH
NGFRAP1 cDNA ORF Clone, Human, N-His tag HG16216-NH
NGFRAP1 cDNA ORF Clone, Human, C-HA tag HG16216-CY
NGFRAP1 cDNA ORF Clone, Human, N-HA tag HG16216-NY
NGFRAP1 cDNA ORF Clone, Human, C-Myc tag HG16216-CM
NGFRAP1 qPCR Primer Pairs, Human HP104981
info info
添加购物车成功! 添加购物车失败!