NEU2 cDNA ORF Clone, Human, C-HA tag

Cat: HG15845-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NEU2 Reagents
CRO Services
Product recommended

All NEU2 Reagents
NEU2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1143 bp
Description
Full length Clone DNA of Human sialidase 2 (cytosolic sialidase) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEU2 cDNA ORF Clone, Human, C-HA tag Alternative Names
SIAL2 cDNA ORF Clone, Human
NEU2 Background Information
Full Name
sialidase 2 (cytosolic sialidase)

NEU2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NEU2 cDNA ORF Clone in Cloning Vector, Mouse MG51574-G
NEU2 cDNA ORF Clone, Mouse, untagged MG51574-UT
NEU2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51574-ACGLN
NEU2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51574-ACG
NEU2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51574-ANG
NEU2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51574-ACR
NEU2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51574-ANR
NEU2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51574-CF
NEU2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51574-NF
NEU2 cDNA ORF Clone, Mouse, C-His tag MG51574-CH
NEU2 cDNA ORF Clone, Mouse, N-His tag MG51574-NH
NEU2 cDNA ORF Clone, Mouse, C-HA tag MG51574-CY
NEU2 cDNA ORF Clone, Mouse, N-HA tag MG51574-NY
NEU2 cDNA ORF Clone, Mouse, C-Myc tag MG51574-CM
NEU2 cDNA ORF Clone, Mouse, N-Myc tag MG51574-NM
NEU2 qPCR Primer Pairs, Mouse MP201457

NEU2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NEU2 cDNA ORF Clone in Cloning Vector, Human HG15845-G
NEU2 cDNA ORF Clone, Human, untagged HG15845-UT
NEU2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15845-ACG
NEU2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15845-ACGLN
NEU2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15845-ANG
NEU2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15845-ACR
NEU2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15845-ANR
NEU2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15845-CF
NEU2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15845-NF
NEU2 cDNA ORF Clone, Human, C-His tag HG15845-CH
NEU2 cDNA ORF Clone, Human, N-His tag HG15845-NH
NEU2 cDNA ORF Clone, Human, N-HA tag HG15845-NY
NEU2 cDNA ORF Clone, Human, C-Myc tag HG15845-CM
NEU2 cDNA ORF Clone, Human, N-Myc tag HG15845-NM
NEU2 qPCR Primer Pairs, Human HP104436
info info
添加购物车成功! 添加购物车失败!