NETO1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11562-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NETO1 Reagents
CRO Services
Product recommended

All NETO1 Reagents
NETO1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1602 bp
Description
Full length Clone DNA of Human neuropilin (NRP) and tolloid (TLL)-like 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NETO1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
BCTL1 cDNA ORF Clone, Human;BTCL1 cDNA ORF Clone, Human
NETO1 Background Information

Neuropilin tolloid-like 1 (NETO1), a complement C1r/C1s, Uegf, Bmp1 (CUB) domain-containing transmembrane protein, is a novel component of the NMDAR complex critical for maintaining the abundance of NR2A-containing NMDARs in the postsynaptic density. The N-methyl-D-aspartate receptor (NMDAR), a major excitatory ligand-gated ion channel in the central nervous system (CNS), is a principal mediator of synaptic plasticity. Both NETO1 and NETO2 share an identical and unique domain structure thus representing a novel subfamily of CUB- and LDLa-containing proteins. The cytoplasmic domains of NETO1 and NETO2 are not homologous to other known protein sequences but contain a conserved FXNPXY-like motif, which is essential for the internalization of clathrin coated pits during endocytosis or alternatively, may be implicated in intracellular signaling pathways. NETO1 and NETO2, have marked effects on receptor properties, increasing further the potential diversity of Kainate receptors (KARs) functional properties. NETO1 involves in the development and/or maintenance of neuronal circuitry. NETO1 regulates long-term NMDA receptor-dependent synaptic plasticity and cognition, at least in the context of spatial learning and memory.

Full Name
neuropilin (NRP) and tolloid (TLL)-like 1
References
  • Sthr H, et al. (2002) A novel gene encoding a putative transmembrane protein with two extracellular CUB domains and a low-density lipoprotein class A module: isolation of alternatively spliced isoforms in retina and brain. Gene. 286(2): 223-31.
  • Ng D, et al.d for synaptic plasticity and learning. PLoS Biol. 7(2): e41.
  • Perrais D, et al. (2010) Gating and permeation of kainate receptors: differences unveiled. Trends Pharmacol Sci. 31(11): 516-22.
  • NETO1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NETO1 cDNA ORF Clone in Cloning Vector, Mouse MG50948-G
    NETO1 cDNA ORF Clone, Mouse, untagged MG50948-UT
    NETO1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50948-ACG
    NETO1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50948-ACGLN
    NETO1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50948-ACR
    NETO1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50948-CF
    NETO1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50948-NF
    NETO1 cDNA ORF Clone, Mouse, C-His tag MG50948-CH
    NETO1 cDNA ORF Clone, Mouse, N-His tag MG50948-NH
    NETO1 cDNA ORF Clone, Mouse, C-HA tag MG50948-CY
    NETO1 cDNA ORF Clone, Mouse, N-HA tag MG50948-NY
    NETO1 cDNA ORF Clone, Mouse, C-Myc tag MG50948-CM
    NETO1 cDNA ORF Clone, Mouse, N-Myc tag MG50948-NM
    NETO1 qPCR Primer Pairs, Mouse MP200917

    NETO1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NETO1 cDNA ORF Clone in Cloning Vector, Human HG11562-M
    NETO1 cDNA ORF Clone, Human, untagged HG11562-UT
    NETO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11562-ACG
    NETO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11562-ACGLN
    NETO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11562-ACR
    NETO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11562-CF
    NETO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11562-NF
    NETO1 cDNA ORF Clone, Human, C-His tag HG11562-CH
    NETO1 cDNA ORF Clone, Human, N-His tag HG11562-NH
    NETO1 cDNA ORF Clone, Human, C-HA tag HG11562-CY
    NETO1 cDNA ORF Clone, Human, N-HA tag HG11562-NY
    NETO1 cDNA ORF Clone, Human, C-Myc tag HG11562-CM
    NETO1 qPCR Primer Pairs, Human HP101427
    info info
    添加购物车成功! 添加购物车失败!