NEK7 cDNA ORF Clone, Human, N-His tag

Cat: HG11534-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NEK7 Reagents
CRO Services
Product recommended

All NEK7 Reagents
NEK7 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
909 bp
Description
Full length Clone DNA of Human NIMA (never in mitosis gene a)-related kinase 7 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEK7 Background Information

NIMA (never in mitosis gene a)-related kinase 7, NEK7 belongs to the NIMA subfamily, NEK Ser/Thr protein kinase family, protein kinase superfamily. NEKs (NIMA-related kinases) are mammalian serine/threonine (Ser/Thr) protein kinases structurally related to Aspergillus NIMA (Never in Mitosis, gene A), which plays essential roles in mitotic signaling. NEKs share an amino-terminal catalytic domain related to NIMA, an Aspergillus kinase involved in the control of several aspects of mitosis, and divergent carboxyl-terminal tails of varying length. NEKs are commonly referred to as mitotic kinases, although a definitive in vivo verification of this definition is largely missing. Reduction in the activity of NEK7 or its close paralog, NEK6, has previously been shown to arrest cells in mitosis, mainly at metaphase. NEK7 is a regulator of cell division, and reveal it as an essential component for mammalian growth and survival. The intimate connection between tetraploidy, aneuploidy and cancer development suggests that NEK7 deregulation can induce oncogenesis. The endogenous NEK7 protein is enriched at the centrosome in a microtubule-independent manner. Overexpression of wt or kinase-defective NEK7 resulted in cells of rounder appearance, and higher proportions of multinuclear and apoptotic cells.

Full Name
NIMA-related kinase 7
References
  • Belham C, et al. (2003) A mitotic cascade of NIMA family kinases. Nercc1/Nek9 activates the Nek6 and Nek7 kinases. J Biol Chem. 278(37): 34897-909.
  • Minoguchi S, et al.. (2003) Differential control of the NIMA-related kinases, Nek6 and Nek7, by serum stimulation. Biochem Biophys Res Commun. 301(4): 899-906.
  • Yissachar N, et al. (2006) Nek7 kinase is enriched at the centrosome, and is required for proper spindle assembly and mitotic progression. FEBS Lett. 580(27): 6489-95.
  • Salem H, et al. (2010) Nek7 kinase targeting leads to early mortality, cytokinesis disturbance and polyploidy. Oncogene. 29(28): 4046-57.
  • info info
    添加购物车成功! 添加购物车失败!