Quick Order

Human NEGR1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human NEGR1 cDNA Clone Product Information
    NCBI RefSeq:NM_173808.2
    RefSeq ORF Size:1065bp
    cDNA Description:Full length Clone DNA of Homo sapiens neuronal growth regulator 1.
    Gene Synonym:Ntra, KILON, IGLON4, DMML2433, MGC46680, NEGR1
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:pCMV3-NEGR1
    Restriction Site:HindIII + XbaI (6.1kb + 1.07kb)
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 888C/T not causing the amino acid variation.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NEGR1 qPCR primers for gene expression analysis, HP101087 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Neuronal Growth Regulator 1, NEGR1, also known as neurotractin, or KILON, which belongs to the immunoglobulin superfamily, IgLON family. This GPI-linked cell surface glycoprotein NEGR1 is composed of three Ig-like domains and belongs to the IgLON subgroup of neural IgSF members. It is expressed in two isoforms with apparent molecular masses of 50 and 37 kD, termed L-form and S-form, respectively. NEGR1/Neurotractin participates in the regulation of neurite outgrowth in the developing brain, and is expressed on neurites of primary hippocampal neurons. Neurotractin/KILON is a trans-neural growth-promoting factor for outgrowing axons following hippocampal denervation. KILON (kindred of IgLON) and opioid-binding cell adhesion molecule belong to the IgLON subgroup of immunoglobulin superfamily together with the limbic system-associated membrane protein and neurotrimin. The alteration of modulatory function of KILON/NEGR1 for the number of dendritic synapses concomitant with changes in its localization and detergent solubility during neuronal culture development. In addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.

    References
  • Marg A, et al. (1999) Neurotractin, a novel neurite outgrowth-promoting Ig-like protein that interacts with CEPU-1 and LAMP. J Cell Biol. 145(4): 865-76.
  • Miyata S, et al. (2003) Biochemical and ultrastructural analyses of IgLON cell adhesion molecules, Kilon and OBCAM in the rat brain. Neuroscience. 117(3): 645-58.
  • Schfer M, et al. (2005) Neurotractin/kilon promotes neurite outgrowth and is expressed on reactive astrocytes after entorhinal cortex lesion. Mol Cell Neurosci. 29(4): 580-90.
  • Hashimoto T, et al. (2008) IgLON cell adhesion molecule Kilon is a crucial modulator for synapse number in hippocampal neurons. Brain Res. 1224: 1-11.
  • Size / Price
    Catalog: HG11181-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"