NEDD4 cDNA ORF Clone, Human, N-His tag

Cat: HG11437-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NEDD4 Reagents
CRO Services
Product recommended

All NEDD4 Reagents
NEDD4 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2748 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2616T/G not causing the amino acid variation.
Description
Full length Clone DNA of Human neural precursor cell expressed, developmentally down-regulated 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
HindIII + NotI(6kb+2.75kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
NEDD4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEDD4 cDNA ORF Clone, Human, N-His tag Validated Images
Human DHCR7 Gene Plasmid Map 5861
NEDD4 cDNA ORF Clone, Human, N-His tag Alternative Names
NEDD4-1 cDNA ORF Clone, Human;RPF1 cDNA ORF Clone, Human
NEDD4 Background Information
Full Name
neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase

NEDD4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NEDD4 cDNA ORF Clone in Cloning Vector, Rat RG82554-U
NEDD4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82554-ACGLN

NEDD4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NEDD4 cDNA ORF Clone in Cloning Vector, Mouse MG58045-U
NEDD4 cDNA ORF Clone, Mouse, untagged MG58045-UT
NEDD4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58045-ACG
NEDD4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58045-ACGLN
NEDD4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58045-ANG
NEDD4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58045-ACR
NEDD4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58045-ANR
NEDD4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58045-CF
NEDD4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58045-NF
NEDD4 cDNA ORF Clone, Mouse, C-His tag MG58045-CH
NEDD4 cDNA ORF Clone, Mouse, N-His tag MG58045-NH
NEDD4 cDNA ORF Clone, Mouse, C-HA tag MG58045-CY
NEDD4 cDNA ORF Clone, Mouse, N-HA tag MG58045-NY
NEDD4 cDNA ORF Clone, Mouse, C-Myc tag MG58045-CM
NEDD4 cDNA ORF Clone, Mouse, N-Myc tag MG58045-NM

NEDD4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NEDD4 cDNA ORF Clone in Cloning Vector, Human HG11437-G
NEDD4 cDNA ORF Clone, Human, untagged HG11437-UT
NEDD4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11437-ACGLN
NEDD4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11437-ACG
NEDD4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11437-ACR
NEDD4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11437-CF
NEDD4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11437-NF
NEDD4 cDNA ORF Clone, Human, C-His tag HG11437-CH
NEDD4 cDNA ORF Clone, Human, C-HA tag HG11437-CY
NEDD4 cDNA ORF Clone, Human, N-HA tag HG11437-NY
NEDD4 cDNA ORF Clone, Human, C-Myc tag HG11437-CM
NEDD4 cDNA ORF Clone, Human, N-Myc tag HG11437-NM
NEDD4 qPCR Primer Pairs, Human HP101314
info info
添加购物车成功! 添加购物车失败!