NDUFA9 cDNA ORF Clone, Human, N-HA tag

Cat: HG16430-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NDUFA9 Reagents
CRO Services
Product recommended

All NDUFA9 Reagents
NDUFA9 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1134 bp
Description
Full length Clone DNA of Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDUFA9 cDNA ORF Clone, Human, N-HA tag Alternative Names
CC6 cDNA ORF Clone, Human;CI-39k cDNA ORF Clone, Human;CI39k cDNA ORF Clone, Human;NDUFS2L cDNA ORF Clone, Human;SDR22E1 cDNA ORF Clone, Human
NDUFA9 Background Information
Full Name
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa

NDUFA9 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
NDUFA9 cDNA ORF Clone in Cloning Vector, Canine DG70236-U
NDUFA9 cDNA ORF Clone, Canine, untagged DG70236-UT
NDUFA9 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70236-ACG
NDUFA9 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70236-ACGLN
NDUFA9 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70236-ANG
NDUFA9 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70236-ACR
NDUFA9 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70236-ANR
NDUFA9 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70236-CF
NDUFA9 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70236-NF
NDUFA9 cDNA ORF Clone, Canine, C-His tag DG70236-CH
NDUFA9 cDNA ORF Clone, Canine, N-His tag DG70236-NH
NDUFA9 cDNA ORF Clone, Canine, C-HA tag DG70236-CY
NDUFA9 cDNA ORF Clone, Canine, N-HA tag DG70236-NY
NDUFA9 cDNA ORF Clone, Canine, C-Myc tag DG70236-CM
NDUFA9 cDNA ORF Clone, Canine, N-Myc tag DG70236-NM

NDUFA9 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDUFA9 cDNA ORF Clone in Cloning Vector, Rat RG80810-U
NDUFA9 cDNA ORF Clone, Rat, untagged RG80810-UT
NDUFA9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80810-ACGLN
NDUFA9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80810-ACG
NDUFA9 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80810-ANG
NDUFA9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80810-ACR
NDUFA9 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80810-ANR
NDUFA9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80810-CF
NDUFA9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80810-NF
NDUFA9 cDNA ORF Clone, Rat, C-His tag RG80810-CH
NDUFA9 cDNA ORF Clone, Rat, N-His tag RG80810-NH
NDUFA9 cDNA ORF Clone, Rat, C-HA tag RG80810-CY
NDUFA9 cDNA ORF Clone, Rat, N-HA tag RG80810-NY
NDUFA9 cDNA ORF Clone, Rat, C-Myc tag RG80810-CM
NDUFA9 cDNA ORF Clone, Rat, N-Myc tag RG80810-NM
NDUFA9 qPCR Primer Pairs, Rat RP300774

NDUFA9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDUFA9 cDNA ORF Clone in Cloning Vector, Mouse MG53133-G
NDUFA9 cDNA ORF Clone, Mouse, untagged MG53133-UT
NDUFA9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53133-ACGLN
NDUFA9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53133-ACG
NDUFA9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53133-ANG
NDUFA9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53133-ACR
NDUFA9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53133-ANR
NDUFA9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53133-CF
NDUFA9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53133-NF
NDUFA9 cDNA ORF Clone, Mouse, C-His tag MG53133-CH
NDUFA9 cDNA ORF Clone, Mouse, N-His tag MG53133-NH
NDUFA9 cDNA ORF Clone, Mouse, C-HA tag MG53133-CY
NDUFA9 cDNA ORF Clone, Mouse, N-HA tag MG53133-NY
NDUFA9 cDNA ORF Clone, Mouse, C-Myc tag MG53133-CM
NDUFA9 cDNA ORF Clone, Mouse, N-Myc tag MG53133-NM

NDUFA9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDUFA9 cDNA ORF Clone in Cloning Vector, Human HG16430-G
NDUFA9 cDNA ORF Clone, Human, untagged HG16430-UT
NDUFA9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16430-ACGLN
NDUFA9 cDNA ORF Clone, Human, C-GFPSpark® tag HG16430-ACG
NDUFA9 cDNA ORF Clone, Human, N-GFPSpark® tag HG16430-ANG
NDUFA9 cDNA ORF Clone, Human, C-OFPSpark® tag HG16430-ACR
NDUFA9 cDNA ORF Clone, Human, N-OFPSpark® tag HG16430-ANR
NDUFA9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16430-CF
NDUFA9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16430-NF
NDUFA9 cDNA ORF Clone, Human, C-His tag HG16430-CH
NDUFA9 cDNA ORF Clone, Human, N-His tag HG16430-NH
NDUFA9 cDNA ORF Clone, Human, C-HA tag HG16430-CY
NDUFA9 cDNA ORF Clone, Human, C-Myc tag HG16430-CM
NDUFA9 cDNA ORF Clone, Human, N-Myc tag HG16430-NM
NDUFA9 qPCR Primer Pairs, Human HP105179
info info
添加购物车成功! 添加购物车失败!