NDRG1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14119-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NDRG1 Reagents
CRO Services
Product recommended

All NDRG1 Reagents
NDRG1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1185 bp
Description
Full length Clone DNA of Human N-myc downstream regulated 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDRG1 cDNA ORF Clone, Human, N-HA tag Alternative Names
CAP43 cDNA ORF Clone, Human;CMT4D cDNA ORF Clone, Human;DRG-1 cDNA ORF Clone, Human;DRG1 cDNA ORF Clone, Human;GC4 cDNA ORF Clone, Human;HMSNL cDNA ORF Clone, Human;NDR1 cDNA ORF Clone, Human;NMSL cDNA ORF Clone, Human;PROXY1 cDNA ORF Clone, Human;RIT42 cDNA ORF Clone, Human;RTP cDNA ORF Clone, Human;TARG1 cDNA ORF Clone, Human;TDD5 cDNA ORF Clone, Human
NDRG1 Background Information

NDRG1 gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. NDRG1 is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. NDRG1 is necessary for p53-mediated caspase activation and apoptosis. Mutations in NDRG1 gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. NDRG1 is a stress-responsive protein involved in hormone responses, cell growth, and differentiation. It acts as a tumor suppressor in many cell types.

Full Name
N-myc downstream regulated 1
References
  • Kachhap SK, et al. (2007) The N-Myc down regulated Gene1 (NDRG1) Is a Rab4a effector involved in vesicular recycling of E-cadherin. PLoS ONE. 2(9):e844.
  • Zhang J, et al. (2008) Human differentiation-related gene NDRG1 is a Myc downstream-regulated gene that is repressed by Myc on the core promoter region. Gene. 417(1-2):5-12.
  • Kokame K, et al. (1997) Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. GRP78/BiP and novel genes. J Biol Chem. 271(47): 29659-65.
  • NDRG1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    NDRG1 cDNA ORF Clone in Cloning Vector, Rat RG86071-U
    NDRG1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86071-ACGLN

    NDRG1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NDRG1 cDNA ORF Clone in Cloning Vector, Mouse MG53154-G
    NDRG1 cDNA ORF Clone, Mouse, untagged MG53154-UT
    NDRG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53154-ACG
    NDRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53154-ACGLN
    NDRG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53154-ANG
    NDRG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53154-ACR
    NDRG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53154-ANR
    NDRG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53154-CF
    NDRG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53154-NF
    NDRG1 cDNA ORF Clone, Mouse, C-His tag MG53154-CH
    NDRG1 cDNA ORF Clone, Mouse, N-His tag MG53154-NH
    NDRG1 cDNA ORF Clone, Mouse, C-HA tag MG53154-CY
    NDRG1 cDNA ORF Clone, Mouse, N-HA tag MG53154-NY
    NDRG1 cDNA ORF Clone, Mouse, C-Myc tag MG53154-CM
    NDRG1 cDNA ORF Clone, Mouse, N-Myc tag MG53154-NM

    NDRG1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NDRG1 cDNA ORF Clone in Cloning Vector, Human HG14119-G
    NDRG1 cDNA ORF Clone, Human, untagged HG14119-UT
    NDRG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14119-ACG
    NDRG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14119-ACGLN
    NDRG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14119-ANG
    NDRG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14119-ACR
    NDRG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14119-ANR
    NDRG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14119-CF
    NDRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14119-NF
    NDRG1 cDNA ORF Clone, Human, C-His tag HG14119-CH
    NDRG1 cDNA ORF Clone, Human, N-His tag HG14119-NH
    NDRG1 cDNA ORF Clone, Human, C-HA tag HG14119-CY
    NDRG1 cDNA ORF Clone, Human, C-Myc tag HG14119-CM
    NDRG1 cDNA ORF Clone, Human, N-Myc tag HG14119-NM
    NDRG1 qPCR Primer Pairs, Human HP102772
    info info
    添加购物车成功! 添加购物车失败!