After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NDRG1 / CAP43 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human NDRG1 cDNA Clone Product Information
NCBI RefSeq:BC003175
RefSeq ORF Size:1185bp
cDNA Description:Full length Clone DNA of Homo sapiens N-myc downstream regulated 1 with C terminal His tag.
Gene Synonym:CAP43, CMT4D, DRG-1, DRG1, GC4, HMSNL, NDR1, NMSL, PROXY1, RIT42, RTP, TARG1, TDD5, NDRG1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

NDRG1 gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. NDRG1 is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. NDRG1 is necessary for p53-mediated caspase activation and apoptosis. Mutations in NDRG1 gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. NDRG1 is a stress-responsive protein involved in hormone responses, cell growth, and differentiation. It acts as a tumor suppressor in many cell types.

References
  • Kachhap SK, et al. (2007) The N-Myc down regulated Gene1 (NDRG1) Is a Rab4a effector involved in vesicular recycling of E-cadherin. PLoS ONE. 2(9):e844.
  • Zhang J, et al. (2008) Human differentiation-related gene NDRG1 is a Myc downstream-regulated gene that is repressed by Myc on the core promoter region. Gene. 417(1-2):5-12.
  • Kokame K, et al. (1997) Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. GRP78/BiP and novel genes. J Biol Chem. 271(47): 29659-65.
  • Size / Price
    Catalog: HG14119-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"