NDFIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14656-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NDFIP1 Reagents
CRO Services
Product recommended

All NDFIP1 Reagents
NDFIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
666 bp
Description
Full length Clone DNA of Human Nedd4 family interacting protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDFIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
N4WBP5 cDNA ORF Clone, Human
NDFIP1 Background Information
Full Name
Nedd4 family interacting protein 1

NDFIP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDFIP1 cDNA ORF Clone in Cloning Vector, Rat RG81174-U
NDFIP1 cDNA ORF Clone, Rat, untagged RG81174-UT
NDFIP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81174-ACG
NDFIP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81174-ACGLN
NDFIP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81174-ACR
NDFIP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81174-CF
NDFIP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81174-NF
NDFIP1 cDNA ORF Clone, Rat, C-His tag RG81174-CH
NDFIP1 cDNA ORF Clone, Rat, N-His tag RG81174-NH
NDFIP1 cDNA ORF Clone, Rat, C-HA tag RG81174-CY
NDFIP1 cDNA ORF Clone, Rat, N-HA tag RG81174-NY
NDFIP1 cDNA ORF Clone, Rat, C-Myc tag RG81174-CM
NDFIP1 cDNA ORF Clone, Rat, N-Myc tag RG81174-NM
NDFIP1 qPCR Primer Pairs, Rat RP301130

NDFIP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDFIP1 cDNA ORF Clone in Cloning Vector, Mouse MG59499-U
NDFIP1 cDNA ORF Clone, Mouse, untagged MG59499-UT
NDFIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59499-ACGLN
NDFIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59499-ACG
NDFIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59499-ACR
NDFIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59499-CF
NDFIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59499-NF
NDFIP1 cDNA ORF Clone, Mouse, C-His tag MG59499-CH
NDFIP1 cDNA ORF Clone, Mouse, N-His tag MG59499-NH
NDFIP1 cDNA ORF Clone, Mouse, C-HA tag MG59499-CY
NDFIP1 cDNA ORF Clone, Mouse, N-HA tag MG59499-NY
NDFIP1 cDNA ORF Clone, Mouse, C-Myc tag MG59499-CM
NDFIP1 cDNA ORF Clone, Mouse, N-Myc tag MG59499-NM

NDFIP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDFIP1 cDNA ORF Clone in Cloning Vector, Human HG14656-G
NDFIP1 cDNA ORF Clone, Human, untagged HG14656-UT
NDFIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14656-ACGLN
NDFIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14656-ACG
NDFIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14656-ACR
NDFIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14656-CF
NDFIP1 cDNA ORF Clone, Human, C-His tag HG14656-CH
NDFIP1 cDNA ORF Clone, Human, N-His tag HG14656-NH
NDFIP1 cDNA ORF Clone, Human, C-HA tag HG14656-CY
NDFIP1 cDNA ORF Clone, Human, N-HA tag HG14656-NY
NDFIP1 cDNA ORF Clone, Human, C-Myc tag HG14656-CM
NDFIP1 cDNA ORF Clone, Human, N-Myc tag HG14656-NM
NDFIP1 qPCR Primer Pairs, Human HP103290
info info
添加购物车成功! 添加购物车失败!