After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human NCR2 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human NCR2 cDNA Clone Product Information
NCBI RefSeq:NM_004828.3
RefSeq ORF Size:831bp
cDNA Description:Full length Clone DNA of Homo sapiens natural cytotoxicity triggering receptor 2 with N terminal Myc tag.
Gene Synonym:LY95, CD336, NKP44, NK-p44, dJ149M18.1, NCR2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Natural cytotoxicity triggering receptor 2 (NCR2), also known as Natural killer cell p44-related protein (NKp44), or CD336, is a member of the natural cytotoxicity receptor (NCR) family, which composed of one Ig-like extracellular domain, a transmembrane segment, and a cytoplasmic domain. It is a novel transmembrane glycoprotein belonging to the Immunoglobulin superfamily characterized by a single extracellular V-type domain. The cytoplasmic domain of NKp44 also contains a sequence that matches the immunoreceptor tyrosine-based inhibitory motif (ITIM) consensus. This Cytotoxicity-activating receptor that may contribute to the increased efficiency of activated natural killer (NK) cells to mediate tumor cell lysis. NKp44 is selectively expressed by IL-2-activated NK cells and may contribute to the increased efficiency of activated NK cells to mediate tumor cell lysis. Tumor cell recognition of the mutated NKp44 proteins was significantly reduced and correlated with their lower recognition of heparin.

References
  • Vitale M, et al. (1998) NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis. J Exp Med. 187(12): 2065-72.
  • Cantoni C, et al. (1999) NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J Exp Med. 189: 787-96.
  • Cantoni C, et al. (2003) The three-dimensional structure of the human NK cell receptor NKp44, a triggering partner in natural cytotoxicity. Structure. 11(6): 725-34.
  • Campbell KS, et al. (2004) NKp44 triggers NK cell activation through DAP12 association that is not influenced by a putative cytoplasmic inhibitory sequence. J Immunol. 172(2): 899-906.
  • Hershkovitz O, et al. (2007) Characterization of the recognition of tumor cells by the natural cytotoxicity receptor, NKp44. Biochemistry. 46(25): 7426-36.
  • Size / Price
    Catalog: HG11550-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"