Quick Order

Text Size:AAA

Human NCR1 / NK-p46 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human NCR1 cDNA Clone Product Information
NCBI RefSeq:BC064806
RefSeq ORF Size:912bp
cDNA Description:Full length Clone DNA of Homo sapiens natural cytotoxicity triggering receptor 1 with N terminal Myc tag.
Gene Synonym:XXbac-BCX195L8.10-004, CD335, FLJ99094, LY94, NK-p46, NKP46, NCR1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

NCR1, also known as NK-p46 and CD335, is a natural cytotoxicity receptor(NCR). NCRs are type I transmembrane proteins with 1-2 extracellular immunoglobulin domains, a transmembrane domain containing a positively charged amino acid residue, and a short cytoplasmic tail. All are expressed almost exclusively by NK cells and play a major role in triggering NK-mediated killing of most tumor cell lines. NKp46 has two extracellular Ig-like domains followed by a ~40 residue stalk region, a type I transmembrane domain, and a short cytoplasmic tail. NKp46 has been implicated in NK cell-mediated lysis of several autologous tumor cells, pathogen-infected cell lines and mononuclear phagocytes infected with an intracellular bacterium.

References
  • Carbone E, et al. (2005) HLA class I, NKG2D, and natural cytotoxicity receptors regulate multiple myeloma cell recognition by natural killer cells. Blood. 105(1):251-8.
  • Sivori S, et al. (1997) p46, a Novel Natural Killer Cell-specific Surface Molecule That Mediates Cell Activation. J Exp Med. 186(7):1129-36.
  • Biassoni R, et al. (2004) Human natural killer cell receptors: insights into their molecular function and structure. J Cell Mol Med. 7(4):376-87.
  • Size / Price
    Catalog: HG13772-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"