Quick Order

Human NAPG/ gamma SNAP Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human NAPG cDNA Clone Product Information
    NCBI RefSeq:BC001889
    RefSeq ORF Size:939bp
    cDNA Description:Full length Clone DNA of Homo sapiens N-ethylmaleimide-sensitive factor attachment protein, gamma with C terminal His tag.
    Gene Synonym:GAMMASNAP
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NAPG qPCR primers for gene expression analysis, HP103343 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    NAPG, also known as gamma SNAP, belongs to the SNAP family. SNAPs enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. NAPG mediates platelet exocytosis and controls the membrane fusion events of this process. It is required for vesicular transport between the endoplasmic reticulum and the Golgi apparatus.

    References
  • Lemons PP. et al., 1997, J Cell Biol. 117 (3): 531-8.
  • Chen D. et al., 2001, J Biol Chem. 276 (16): 13127-35.
  • Whiteheart SW. et al., 1992, J Biol Chem. 267 (17): 12239-43.
  • Size / Price
    Catalog: HG14709-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"