After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human NAPG/ gamma SNAP Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human NAPG cDNA Clone Product Information
NCBI RefSeq:BC001889
RefSeq ORF Size:939bp
cDNA Description:Full length Clone DNA of Homo sapiens N-ethylmaleimide-sensitive factor attachment protein, gamma with C terminal HA tag.
Gene Synonym:GAMMASNAP
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

NAPG, also known as gamma SNAP, belongs to the SNAP family. SNAPs enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. NAPG mediates platelet exocytosis and controls the membrane fusion events of this process. It is required for vesicular transport between the endoplasmic reticulum and the Golgi apparatus.

References
  • Lemons PP. et al., 1997, J Cell Biol. 117 (3): 531-8.
  • Chen D. et al., 2001, J Biol Chem. 276 (16): 13127-35.
  • Whiteheart SW. et al., 1992, J Biol Chem. 267 (17): 12239-43.
  • Size / Price
    Catalog: HG14709-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"