Quick Order

Human Alpha-galactosidase B Gene ORF cDNA clone expression plasmid, N-His tag

  • Human CNDP1 Gene Plasmid Map 5655
DatasheetReviewsRelated ProductsProtocols
Human NAGA cDNA Clone Product Information
NCBI RefSeq:NM_000262.2
RefSeq ORF Size:1278 bp
cDNA Description:Full length Clone DNA of Homo sapiens N-acetylgalactosaminidase, alpha with N terminal His tag.
Gene Synonym:GALB, D22S674, NAGA
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-SP-His-NAGA
Restriction Site:HindIII + NotI(6kb+1.28kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 321G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with NAGA qPCR primers for gene expression analysis, HP102365 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG13686-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"