Quick Order

Human NAE1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human NAE1 cDNA Clone Product Information
NCBI RefSeq:BC000480
RefSeq ORF Size:1605bp
cDNA Description:Full length Clone DNA of Homo sapiens NEDD8 activating enzyme E1 subunit 1.
Gene Synonym:HPP1, A-116A10.1, APPBP1, ula-1, NAE1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG14282-UT
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"