ARD1A cDNA ORF Clone, Human, untagged

Cat: HG14293-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARD1A Reagents
CRO Services
Product recommended

All ARD1A Reagents
ARD1A cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
708 bp
Description
Full length Clone DNA of Human N(alpha)-acetyltransferase 10, NatA catalytic subunit.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARD1A cDNA ORF Clone, Human, untagged Alternative Names
ARD1 cDNA ORF Clone, Human;ARD1A cDNA ORF Clone, Human;ARD1P cDNA ORF Clone, Human;DXS707 cDNA ORF Clone, Human;MCOPS1 cDNA ORF Clone, Human;NAA10 cDNA ORF Clone, Human;NATD cDNA ORF Clone, Human;OGDNS cDNA ORF Clone, Human;TE2 cDNA ORF Clone, Human
ARD1A Background Information

ARD1 is a member of the 20-kDa ARF protein family. It is a multifunctional protein. ARD1 has an 18-kDa ADP-ribosylation factor (ARF) domain at the C-terminus (amino acids 403-574), and a 46-kDa N-terminal domain (amino acids 1-402). The C-terminal region of ARD1 may be involved in the formation of both ARD1-ARD1 and ARD1-NAT1 complexes. ARD1 and NAT1 genes are required for the expression of an N-terminal protein acetyltransferase. This activity is required for full repression of the silent mating type locus HML, for sporulation, and for entry into G0. Recombinant ARD1 (amino acids 1-574) or its RING finger domain (amino acids 1-110) produced polyubiquitylated proteins when incubated in vitro with a mammalian E1, an E2 enzyme, ATP, and ubiquitin.

Full Name
N(alpha)-acetyltransferase 10, NatA catalytic subunit
References
  • Tribioli C., et al.,(1994), Isolation of new genes in distal Xq28: transcriptional map and identification of a human homologue of the ARD1 N-acetyl transferase of Saccharomyces cerevisiae. Hum. Mol. Genet. 3:1061-1068.
  • Arnesen T., et al., (2005), Identification and characterization of the human ARD1-NATH protein acetyltransferase complex.Biochem. J. 386:433-443.
  • Ross M.T., et al.,(2005), The DNA sequence of the human X chromosome.Nature 434:325-337.
  • info info
    添加购物车成功! 添加购物车失败!