After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Matriptase/ST14 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human Matriptase/ST14 cDNA Clone Product Information
NCBI RefSeq:NM_021978.3
RefSeq ORF Size:2568bp
cDNA Description:Full length Clone DNA of Homo sapiens suppression of tumorigenicity 14 (colon carcinoma).
Gene Synonym:HAI, MT-SP1, MTSP-1, MTSP1, PRSS14, SNC19, TADG-15
Restriction Site:KpnI + XhoI (5.5kb + 2.57kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 1215C/T mutation not causing amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Matriptase/ST14 Gene Plasmid Map
Human Matriptase / ST14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Contact Us
  • Human Matriptase / ST14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.