Myogenin cDNA ORF Clone, Human, C-His tag

Cat: HG15238-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Myogenin Reagents
CRO Services
Product recommended

All Myogenin Reagents
Myogenin cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Human myogenin (myogenic factor 4) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Myogenin cDNA ORF Clone, Human, C-His tag Alternative Names
bHLHc3 cDNA ORF Clone, Human;myf-4 cDNA ORF Clone, Human;MYF4 cDNA ORF Clone, Human
Myogenin Background Information
Full Name
myogenin

Myogenin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Myogenin cDNA ORF Clone in Cloning Vector, Rat RG83090-U
Myogenin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83090-ACGLN

Myogenin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Myogenin cDNA ORF Clone in Cloning Vector, Mouse MG53527-G
Myogenin cDNA ORF Clone, Mouse, untagged MG53527-UT
Myogenin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53527-ACGLN
Myogenin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53527-ACG
Myogenin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53527-ANG
Myogenin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53527-ACR
Myogenin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53527-ANR
Myogenin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53527-CF
Myogenin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53527-NF
Myogenin cDNA ORF Clone, Mouse, C-His tag MG53527-CH
Myogenin cDNA ORF Clone, Mouse, N-His tag MG53527-NH
Myogenin cDNA ORF Clone, Mouse, C-HA tag MG53527-CY
Myogenin cDNA ORF Clone, Mouse, N-HA tag MG53527-NY
Myogenin cDNA ORF Clone, Mouse, C-Myc tag MG53527-CM
Myogenin cDNA ORF Clone, Mouse, N-Myc tag MG53527-NM

Myogenin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Myogenin cDNA ORF Clone in Cloning Vector, Human HG15238-G
Myogenin cDNA ORF Clone, Human, untagged HG15238-UT
Myogenin cDNA ORF Clone, Human, C-GFPSpark® tag HG15238-ACG
Myogenin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15238-ACGLN
Myogenin cDNA ORF Clone, Human, N-GFPSpark® tag HG15238-ANG
Myogenin cDNA ORF Clone, Human, C-OFPSpark® tag HG15238-ACR
Myogenin cDNA ORF Clone, Human, N-OFPSpark® tag HG15238-ANR
Myogenin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15238-CF
Myogenin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15238-NF
Myogenin cDNA ORF Clone, Human, N-His tag HG15238-NH
Myogenin cDNA ORF Clone, Human, C-HA tag HG15238-CY
Myogenin cDNA ORF Clone, Human, N-HA tag HG15238-NY
Myogenin cDNA ORF Clone, Human, C-Myc tag HG15238-CM
Myogenin cDNA ORF Clone, Human, N-Myc tag HG15238-NM
Myogenin qPCR Primer Pairs, Human HP103864
info info
添加购物车成功! 添加购物车失败!