MYL6 cDNA ORF Clone, Human, untagged

Cat: HG16200-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MYL6 Reagents
CRO Services
Product recommended

All MYL6 Reagents
MYL6 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
456 bp
Description
Full length Clone DNA of Human myosin, light chain 6, alkali, smooth muscle and non-muscle.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MYL6 cDNA ORF Clone, Human, untagged Alternative Names
ESMLC cDNA ORF Clone, Human;LC17 cDNA ORF Clone, Human;LC17-GI cDNA ORF Clone, Human;LC17-NM cDNA ORF Clone, Human;LC17A cDNA ORF Clone, Human;LC17B cDNA ORF Clone, Human;MLC-3 cDNA ORF Clone, Human;MLC1SM cDNA ORF Clone, Human;MLC3NM cDNA ORF Clone, Human;MLC3SM cDNA ORF Clone, Human
MYL6 Background Information
Full Name
myosin, light chain 6, alkali, smooth muscle and non-muscle

MYL6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MYL6 cDNA ORF Clone in Cloning Vector, Mouse MG5A2538-U
MYL6 cDNA ORF Clone, Mouse, untagged MG5A2538-UT
MYL6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2538-ACG
MYL6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2538-ACGLN
MYL6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2538-ANG
MYL6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2538-ACR
MYL6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2538-ANR
MYL6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2538-CF
MYL6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2538-NF
MYL6 cDNA ORF Clone, Mouse, C-His tag MG5A2538-CH
MYL6 cDNA ORF Clone, Mouse, N-His tag MG5A2538-NH
MYL6 cDNA ORF Clone, Mouse, C-HA tag MG5A2538-CY
MYL6 cDNA ORF Clone, Mouse, N-HA tag MG5A2538-NY
MYL6 cDNA ORF Clone, Mouse, C-Myc tag MG5A2538-CM
MYL6 cDNA ORF Clone, Mouse, N-Myc tag MG5A2538-NM

MYL6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MYL6 cDNA ORF Clone in Cloning Vector, Human HG16200-G
MYL6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16200-ACGLN
MYL6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16200-ACG
MYL6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16200-ANG
MYL6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16200-ACR
MYL6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16200-ANR
MYL6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16200-CF
MYL6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16200-NF
MYL6 cDNA ORF Clone, Human, C-His tag HG16200-CH
MYL6 cDNA ORF Clone, Human, N-His tag HG16200-NH
MYL6 cDNA ORF Clone, Human, C-HA tag HG16200-CY
MYL6 cDNA ORF Clone, Human, N-HA tag HG16200-NY
MYL6 cDNA ORF Clone, Human, C-Myc tag HG16200-CM
MYL6 cDNA ORF Clone, Human, N-Myc tag HG16200-NM
MYL6 qPCR Primer Pairs, Human HP104966
info info
添加购物车成功! 添加购物车失败!