MRLC2/MLC-B cDNA ORF Clone, Human, C-Myc tag

Cat: HG10025-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRLC2/MLC-B Reagents
CRO Services
Product recommended

All MRLC2/MLC-B Reagents
MRLC2/MLC-B cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
516 bp
Description
Full length Clone DNA of Human myosin, light chain 12A, regulatory, non-sarcomeric with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRLC2/MLC-B cDNA ORF Clone, Human, C-Myc tag Alternative Names
HEL-S-24 cDNA ORF Clone, Human;MLC-2B cDNA ORF Clone, Human;MLCB cDNA ORF Clone, Human;MRCL3 cDNA ORF Clone, Human;MRLC3 cDNA ORF Clone, Human;MYL2B cDNA ORF Clone, Human
MRLC2/MLC-B Background Information
Full Name
myosin light chain 12A

MRLC2/MLC-B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRLC2/MLC-B cDNA ORF Clone in Cloning Vector, Rat RG80989-U
MRLC2/MLC-B cDNA ORF Clone in Cloning Vector, Rat RG8A6877-U
MRLC2/MLC-B cDNA ORF Clone, Rat, untagged RG80989-UT
MRLC2/MLC-B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6877-ACGLN
MRLC2/MLC-B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80989-ACG
MRLC2/MLC-B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80989-ACGLN
MRLC2/MLC-B cDNA ORF Clone, Rat, N-GFPSpark® tag RG80989-ANG
MRLC2/MLC-B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80989-ACR
MRLC2/MLC-B cDNA ORF Clone, Rat, N-OFPSpark® tag RG80989-ANR
MRLC2/MLC-B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80989-CF
MRLC2/MLC-B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80989-NF
MRLC2/MLC-B cDNA ORF Clone, Rat, C-His tag RG80989-CH
MRLC2/MLC-B cDNA ORF Clone, Rat, N-His tag RG80989-NH
MRLC2/MLC-B cDNA ORF Clone, Rat, C-HA tag RG80989-CY
MRLC2/MLC-B cDNA ORF Clone, Rat, N-HA tag RG80989-NY
MRLC2/MLC-B cDNA ORF Clone, Rat, C-Myc tag RG80989-CM
MRLC2/MLC-B cDNA ORF Clone, Rat, N-Myc tag RG80989-NM
MRLC2/MLC-B qPCR Primer Pairs, Rat RP300953

MRLC2/MLC-B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRLC2/MLC-B cDNA ORF Clone in Cloning Vector, Mouse MG53135-G
MRLC2/MLC-B cDNA ORF Clone, Mouse, untagged MG53135-UT
MRLC2/MLC-B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53135-ACG
MRLC2/MLC-B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53135-ACGLN
MRLC2/MLC-B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53135-ANG
MRLC2/MLC-B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53135-ACR
MRLC2/MLC-B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53135-ANR
MRLC2/MLC-B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53135-CF
MRLC2/MLC-B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53135-NF
MRLC2/MLC-B cDNA ORF Clone, Mouse, C-His tag MG53135-CH
MRLC2/MLC-B cDNA ORF Clone, Mouse, N-His tag MG53135-NH
MRLC2/MLC-B cDNA ORF Clone, Mouse, C-HA tag MG53135-CY
MRLC2/MLC-B cDNA ORF Clone, Mouse, N-HA tag MG53135-NY
MRLC2/MLC-B cDNA ORF Clone, Mouse, C-Myc tag MG53135-CM
MRLC2/MLC-B cDNA ORF Clone, Mouse, N-Myc tag MG53135-NM

MRLC2/MLC-B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRLC2/MLC-B cDNA ORF Clone in Cloning Vector, Human HG10025-M
MRLC2/MLC-B cDNA ORF Clone, Human, untagged HG10025-UT
MRLC2/MLC-B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10025-ACGLN
MRLC2/MLC-B cDNA ORF Clone, Human, C-GFPSpark® tag HG10025-ACG
MRLC2/MLC-B cDNA ORF Clone, Human, N-GFPSpark® tag HG10025-ANG
MRLC2/MLC-B cDNA ORF Clone, Human, C-OFPSpark® tag HG10025-ACR
MRLC2/MLC-B cDNA ORF Clone, Human, N-OFPSpark® tag HG10025-ANR
MRLC2/MLC-B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10025-CF
MRLC2/MLC-B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10025-NF
MRLC2/MLC-B cDNA ORF Clone, Human, C-His tag HG10025-CH
MRLC2/MLC-B cDNA ORF Clone, Human, N-His tag HG10025-NH
MRLC2/MLC-B cDNA ORF Clone, Human, C-HA tag HG10025-CY
MRLC2/MLC-B cDNA ORF Clone, Human, N-HA tag HG10025-NY
MRLC2/MLC-B cDNA ORF Clone, Human, N-Myc tag HG10025-NM
MRLC2/MLC-B qPCR Primer Pairs, Human HP100121
info info
添加购物车成功! 添加购物车失败!