MYCT1 cDNA ORF Clone, Human, N-HA tag

Cat: HG15936-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MYCT1 Reagents
CRO Services
Product recommended

All MYCT1 Reagents
MYCT1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
708 bp
Description
Full length Clone DNA of Human myc target 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MYCT1 cDNA ORF Clone, Human, N-HA tag Alternative Names
MTLC cDNA ORF Clone, Human
MYCT1 Background Information
Full Name
myc target 1

MYCT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MYCT1 cDNA ORF Clone in Cloning Vector, Mouse MG5A3293-U
MYCT1 cDNA ORF Clone, Mouse, untagged MG5A3293-UT
MYCT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3293-ACG
MYCT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3293-ACGLN
MYCT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3293-ANG
MYCT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3293-ACR
MYCT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3293-ANR
MYCT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3293-CF
MYCT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3293-NF
MYCT1 cDNA ORF Clone, Mouse, C-His tag MG5A3293-CH
MYCT1 cDNA ORF Clone, Mouse, N-His tag MG5A3293-NH
MYCT1 cDNA ORF Clone, Mouse, C-HA tag MG5A3293-CY
MYCT1 cDNA ORF Clone, Mouse, N-HA tag MG5A3293-NY
MYCT1 cDNA ORF Clone, Mouse, C-Myc tag MG5A3293-CM
MYCT1 cDNA ORF Clone, Mouse, N-Myc tag MG5A3293-NM

MYCT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MYCT1 cDNA ORF Clone in Cloning Vector, Human HG15936-G
MYCT1 cDNA ORF Clone, Human, untagged HG15936-UT
MYCT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15936-ACGLN
MYCT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15936-ACG
MYCT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15936-ANG
MYCT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15936-ACR
MYCT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15936-ANR
MYCT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15936-CF
MYCT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15936-NF
MYCT1 cDNA ORF Clone, Human, C-His tag HG15936-CH
MYCT1 cDNA ORF Clone, Human, N-His tag HG15936-NH
MYCT1 cDNA ORF Clone, Human, C-HA tag HG15936-CY
MYCT1 cDNA ORF Clone, Human, C-Myc tag HG15936-CM
MYCT1 cDNA ORF Clone, Human, N-Myc tag HG15936-NM
MYCT1 qPCR Primer Pairs, Human HP104524
info info
添加购物车成功! 添加购物车失败!