Text Size:AAA

Human MTOR Gene ORF cDNA clone expression plasmid, C-OFPSpark tag

  • Human MTOR natural ORF mammalian expression plasmid, C-OFPSpark / RFP tag
DatasheetReviewsRelated ProductsProtocols
Human MTOR cDNA Clone Product Information
NCBI RefSeq:NM_004958.3
RefSeq ORF Size:7650bp
cDNA Description:Full length Clone DNA of Homo sapiens mechanistic target of rapamycin (serine/threonine kinase) with C terminal OFPSpark / RFP tag.
Gene Synonym:FRAP, FRAP1, FRAP2, RAFT1, RAPT1, FLJ44809, MTOR
Species:Human
Vector:pCMV3-C-OFPSpark
Plasmid:pCMV3-MTOR-OFPSpark
Restriction Site:HindIII + NotI (6kb + 8.34kb)
Tag Sequence:OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MTOR qPCR primers for gene expression analysis, HP101666 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Human MTOR Gene Plasmid Map
Human MTOR natural ORF mammalian expression plasmid, C-OFPSpark / RFP tag
OFP (OFPSpark) / RFP Tag Info

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Product nameProduct name
Background

The protein encoded by MTOR gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Zhao J, Zhai B, Gygi SP, Goldberg AL. mTOR inhibition activates overall protein degradation by the ubiquitin proteasome system as well as by autophagy. Proceedings of the National Academy of Sciences of the United States of America. 2015;112(52):15790-15797.
  • Size / Price
    Catalog: HG11508-ACR
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"