MTAP cDNA ORF Clone, Human, N-His tag

Cat: HG11417-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MTAP Reagents
CRO Services
Product recommended

All MTAP Reagents
MTAP cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
852 bp
Description
Full length Clone DNA of Human methylthioadenosine phosphorylase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTAP cDNA ORF Clone, Human, N-His tag Alternative Names
BDMF cDNA ORF Clone, Human;c86fus cDNA ORF Clone, Human;DMSFH cDNA ORF Clone, Human;DMSMFH cDNA ORF Clone, Human;HEL-249 cDNA ORF Clone, Human;LGMBF cDNA ORF Clone, Human;MSAP cDNA ORF Clone, Human
MTAP Background Information
Full Name
methylthioadenosine phosphorylase

MTAP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTAP cDNA ORF Clone in Cloning Vector, Mouse MG5A1109-U
MTAP cDNA ORF Clone, Mouse, untagged MG5A1109-UT
MTAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1109-ACGLN
MTAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1109-ACG
MTAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1109-ANG
MTAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1109-ACR
MTAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1109-ANR
MTAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1109-CF
MTAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1109-NF
MTAP cDNA ORF Clone, Mouse, C-His tag MG5A1109-CH
MTAP cDNA ORF Clone, Mouse, N-His tag MG5A1109-NH
MTAP cDNA ORF Clone, Mouse, C-HA tag MG5A1109-CY
MTAP cDNA ORF Clone, Mouse, N-HA tag MG5A1109-NY
MTAP cDNA ORF Clone, Mouse, C-Myc tag MG5A1109-CM
MTAP cDNA ORF Clone, Mouse, N-Myc tag MG5A1109-NM

MTAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTAP cDNA ORF Clone in Cloning Vector, Human HG11417-G
MTAP cDNA ORF Clone, Human, untagged HG11417-UT
MTAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11417-ACGLN
MTAP cDNA ORF Clone, Human, C-GFPSpark® tag HG11417-ACG
MTAP cDNA ORF Clone, Human, N-GFPSpark® tag HG11417-ANG
MTAP cDNA ORF Clone, Human, C-OFPSpark® tag HG11417-ACR
MTAP cDNA ORF Clone, Human, N-OFPSpark® tag HG11417-ANR
MTAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11417-CF
MTAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11417-NF
MTAP cDNA ORF Clone, Human, C-His tag HG11417-CH
MTAP cDNA ORF Clone, Human, C-HA tag HG11417-CY
MTAP cDNA ORF Clone, Human, N-HA tag HG11417-NY
MTAP cDNA ORF Clone, Human, C-Myc tag HG11417-CM
MTAP cDNA ORF Clone, Human, N-Myc tag HG11417-NM
MTAP qPCR Primer Pairs, Human HP101295
info info
添加购物车成功! 添加购物车失败!