MST2/STK3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10640-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MST2/STK3 Reagents
CRO Services
Product recommended

All MST2/STK3 Reagents
MST2/STK3 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1521 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serine/threonine kinase 3 (STE20 homolog, yeast) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI(6kb+1.52kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MST2/STK3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MST2/STK3 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
MST2/STK3 cDNA ORF Clone, Human, C-Myc tag Alternative Names
KRS1 cDNA ORF Clone, Human;MST2 cDNA ORF Clone, Human
MST2/STK3 Background Information
Full Name
serine/threonine kinase 3

MST2/STK3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MST2/STK3 cDNA ORF Clone in Cloning Vector, Mouse MG59953-U
MST2/STK3 cDNA ORF Clone, Mouse, untagged MG59953-UT
MST2/STK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59953-ACGLN
MST2/STK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59953-ACG
MST2/STK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59953-ANG
MST2/STK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59953-ACR
MST2/STK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59953-ANR
MST2/STK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59953-CF
MST2/STK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59953-NF
MST2/STK3 cDNA ORF Clone, Mouse, C-His tag MG59953-CH
MST2/STK3 cDNA ORF Clone, Mouse, N-His tag MG59953-NH
MST2/STK3 cDNA ORF Clone, Mouse, C-HA tag MG59953-CY
MST2/STK3 cDNA ORF Clone, Mouse, N-HA tag MG59953-NY
MST2/STK3 cDNA ORF Clone, Mouse, C-Myc tag MG59953-CM
MST2/STK3 cDNA ORF Clone, Mouse, N-Myc tag MG59953-NM

MST2/STK3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MST2/STK3 cDNA ORF Clone in Cloning Vector, Human HG10640-M
MST2/STK3 cDNA ORF Clone, Human, untagged HG10640-UT
MST2/STK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10640-ACG
MST2/STK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10640-ACGLN
MST2/STK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10640-ANG
MST2/STK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10640-ACR
MST2/STK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10640-ANR
MST2/STK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10640-CF
MST2/STK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10640-NF
MST2/STK3 cDNA ORF Clone, Human, C-His tag HG10640-CH
MST2/STK3 cDNA ORF Clone, Human, N-His tag HG10640-NH
MST2/STK3 cDNA ORF Clone, Human, C-HA tag HG10640-CY
MST2/STK3 cDNA ORF Clone, Human, N-HA tag HG10640-NY
MST2/STK3 cDNA ORF Clone, Human, N-Myc tag HG10640-NM
MST2/STK3 qPCR Primer Pairs, Human HP100613
info info
添加购物车成功! 添加购物车失败!