Quick Order

Human Mesothelin/MSLN Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human MSLN cDNA Clone Product Information
    NCBI RefSeq:BC009272
    RefSeq ORF Size:1869bp
    cDNA Description:Full length Clone DNA of Homo sapiens mesothelin with N terminal Myc tag.
    Gene Synonym:MPF, SMRP, MSLN
    Species:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MSLN qPCR primers for gene expression analysis, HP101748 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Megakaryocyte potentiating factor belongs to the mesothelin family. This family is comprised by several mammalian pre-pro-megakaryocyte potentiating factor precursor (MPF) or mesothelin proteins. Mesothelin is a glycosylphosphatidylinositol-linked glycoprotein highly expressed in mesothelial cells, mesotheliomas, and ovarian cancer, but the biological function of the protein is not known. Megakaryocyte potentiating factor is highly expressed in mesotheliomas, ovarian cancers, and some squamous cell carcinomas (at protein level). It interacts with MUC16 and potentiates megakaryocyte colony formation in vitro. Megakaryocyte potentiating factor is secreted by several mesothelioma cell lines and is frequently elevated in the blood of patients with mesothelioma. Measurement of this protein may be useful in following the response of mesothelioma to treatment.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Chang MC, et al. (2012) Mesothelin enhances invasion of ovarian cancer by inducing MMP-7 through MAPK/ERK and JNK pathways. Biochem J. 442 (2): 293-302.
  • Nelson HH, et al. (2011) The relationship between tumor MSLN methylation and serum mesothelin (SMRP) in mesothelioma. Epigenetics. 6 (8): 1029-34.
  • Bournet B, et al. (2012) Gene expression signature of advanced pancreatic ductal adenocarcinoma using low density array on endoscopic ultrasound-guided fine needle aspiration samples. Pancreatology. 12 (1): 27-34.
  • Size / Price
    Catalog: HG13128-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"