MSI2 cDNA ORF Clone, Human, N-His tag

Cat: HG13069-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MSI2 Reagents
CRO Services
Product recommended

All MSI2 Reagents
MSI2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
987 bp
Description
Full length Clone DNA of Human musashi homolog 2 (Drosophila) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MSI2 cDNA ORF Clone, Human, N-His tag Alternative Names
MSI2H cDNA ORF Clone, Human
MSI2 Background Information
Full Name
musashi RNA-binding protein 2

MSI2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MSI2 cDNA ORF Clone in Cloning Vector, Mouse MG50716-G
MSI2 cDNA ORF Clone, Mouse, untagged MG50716-UT
MSI2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50716-ACGLN
MSI2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50716-ACG
MSI2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50716-ANG
MSI2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50716-ACR
MSI2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50716-ANR
MSI2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50716-CF
MSI2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50716-NF
MSI2 cDNA ORF Clone, Mouse, C-His tag MG50716-CH
MSI2 cDNA ORF Clone, Mouse, N-His tag MG50716-NH
MSI2 cDNA ORF Clone, Mouse, C-HA tag MG50716-CY
MSI2 cDNA ORF Clone, Mouse, N-HA tag MG50716-NY
MSI2 cDNA ORF Clone, Mouse, C-Myc tag MG50716-CM
MSI2 cDNA ORF Clone, Mouse, N-Myc tag MG50716-NM
MSI2 qPCR Primer Pairs, Mouse MP200691

MSI2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MSI2 cDNA ORF Clone in Cloning Vector, Human HG13069-G
MSI2 cDNA ORF Clone, Human, untagged HG13069-UT
MSI2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13069-ACGLN
MSI2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13069-ACG
MSI2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13069-ANG
MSI2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13069-ACR
MSI2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13069-ANR
MSI2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13069-CF
MSI2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13069-NF
MSI2 cDNA ORF Clone, Human, C-His tag HG13069-CH
MSI2 cDNA ORF Clone, Human, C-HA tag HG13069-CY
MSI2 cDNA ORF Clone, Human, N-HA tag HG13069-NY
MSI2 cDNA ORF Clone, Human, C-Myc tag HG13069-CM
MSI2 cDNA ORF Clone, Human, N-Myc tag HG13069-NM
MSI2 qPCR Primer Pairs, Human HP101689
info info
添加购物车成功! 添加购物车失败!