MRPS33 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16387-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPS33 Reagents
CRO Services
Product recommended

All MRPS33 Reagents
MRPS33 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
321 bp
Description
Full length Clone DNA of Human mitochondrial ribosomal protein S33 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPS33 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CGI-139 cDNA ORF Clone, Human;MRP-S33 cDNA ORF Clone, Human;PTD003 cDNA ORF Clone, Human;S33mt cDNA ORF Clone, Human
MRPS33 Background Information
Full Name
mitochondrial ribosomal protein S33

MRPS33 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
MRPS33 cDNA ORF Clone in Cloning Vector, Canine DG70221-U
MRPS33 cDNA ORF Clone, Canine, untagged DG70221-UT
MRPS33 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70221-ACGLN
MRPS33 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70221-ACG
MRPS33 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70221-ANG
MRPS33 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70221-ACR
MRPS33 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70221-ANR
MRPS33 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70221-CF
MRPS33 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70221-NF
MRPS33 cDNA ORF Clone, Canine, C-His tag DG70221-CH
MRPS33 cDNA ORF Clone, Canine, N-His tag DG70221-NH
MRPS33 cDNA ORF Clone, Canine, C-HA tag DG70221-CY
MRPS33 cDNA ORF Clone, Canine, N-HA tag DG70221-NY
MRPS33 cDNA ORF Clone, Canine, C-Myc tag DG70221-CM
MRPS33 cDNA ORF Clone, Canine, N-Myc tag DG70221-NM

MRPS33 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPS33 cDNA ORF Clone in Cloning Vector, Mouse MG52104-U
MRPS33 cDNA ORF Clone, Mouse, untagged MG52104-UT
MRPS33 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52104-ACG
MRPS33 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52104-ACGLN
MRPS33 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52104-ANG
MRPS33 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52104-ACR
MRPS33 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52104-ANR
MRPS33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52104-CF
MRPS33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52104-NF
MRPS33 cDNA ORF Clone, Mouse, C-His tag MG52104-CH
MRPS33 cDNA ORF Clone, Mouse, N-His tag MG52104-NH
MRPS33 cDNA ORF Clone, Mouse, C-HA tag MG52104-CY
MRPS33 cDNA ORF Clone, Mouse, N-HA tag MG52104-NY
MRPS33 cDNA ORF Clone, Mouse, C-Myc tag MG52104-CM
MRPS33 cDNA ORF Clone, Mouse, N-Myc tag MG52104-NM
MRPS33 qPCR Primer Pairs, Mouse MP201977

MRPS33 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPS33 cDNA ORF Clone in Cloning Vector, Human HG16387-G
MRPS33 cDNA ORF Clone, Human, untagged HG16387-UT
MRPS33 cDNA ORF Clone, Human, C-GFPSpark® tag HG16387-ACG
MRPS33 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16387-ACGLN
MRPS33 cDNA ORF Clone, Human, N-GFPSpark® tag HG16387-ANG
MRPS33 cDNA ORF Clone, Human, C-OFPSpark® tag HG16387-ACR
MRPS33 cDNA ORF Clone, Human, N-OFPSpark® tag HG16387-ANR
MRPS33 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16387-NF
MRPS33 cDNA ORF Clone, Human, C-His tag HG16387-CH
MRPS33 cDNA ORF Clone, Human, N-His tag HG16387-NH
MRPS33 cDNA ORF Clone, Human, C-HA tag HG16387-CY
MRPS33 cDNA ORF Clone, Human, N-HA tag HG16387-NY
MRPS33 cDNA ORF Clone, Human, C-Myc tag HG16387-CM
MRPS33 cDNA ORF Clone, Human, N-Myc tag HG16387-NM
MRPS33 qPCR Primer Pairs, Human HP105136
info info
添加购物车成功! 添加购物车失败!