MRPS18B cDNA ORF Clone, Human, untagged

Cat: HG16243-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MRPS18B Reagents
CRO Services
Product recommended

All MRPS18B Reagents
MRPS18B cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
777 bp
Description
Full length Clone DNA of Human mitochondrial ribosomal protein S18B.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPS18B cDNA ORF Clone, Human, untagged Alternative Names
C6orf14 cDNA ORF Clone, Human;HSPC183 cDNA ORF Clone, Human;HumanS18a cDNA ORF Clone, Human;MRP-S18-2 cDNA ORF Clone, Human;MRPS18-2 cDNA ORF Clone, Human;PTD017 cDNA ORF Clone, Human;S18amt cDNA ORF Clone, Human
MRPS18B Background Information
Full Name
mitochondrial ribosomal protein S18B

MRPS18B cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MRPS18B cDNA ORF Clone in Cloning Vector, Rhesus CG90603-G
MRPS18B cDNA ORF Clone, Rhesus, untagged CG90603-UT
MRPS18B cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90603-ACG
MRPS18B Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90603-ACGLN
MRPS18B cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90603-ANG
MRPS18B cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90603-ACR
MRPS18B cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90603-ANR
MRPS18B cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90603-CF
MRPS18B cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90603-NF
MRPS18B cDNA ORF Clone, Rhesus, C-His tag CG90603-CH
MRPS18B cDNA ORF Clone, Rhesus, N-His tag CG90603-NH
MRPS18B cDNA ORF Clone, Rhesus, C-HA tag CG90603-CY
MRPS18B cDNA ORF Clone, Rhesus, N-HA tag CG90603-NY
MRPS18B cDNA ORF Clone, Rhesus, C-Myc tag CG90603-CM
MRPS18B cDNA ORF Clone, Rhesus, N-Myc tag CG90603-NM

MRPS18B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPS18B cDNA ORF Clone in Cloning Vector, Rat RG8A1727-U
MRPS18B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1727-ACGLN

MRPS18B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPS18B cDNA ORF Clone in Cloning Vector, Mouse MG53773-U
MRPS18B cDNA ORF Clone, Mouse, untagged MG53773-UT
MRPS18B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53773-ACGLN
MRPS18B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53773-ACG
MRPS18B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53773-ANG
MRPS18B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53773-ACR
MRPS18B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53773-ANR
MRPS18B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53773-CF
MRPS18B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53773-NF
MRPS18B cDNA ORF Clone, Mouse, C-His tag MG53773-CH
MRPS18B cDNA ORF Clone, Mouse, N-His tag MG53773-NH
MRPS18B cDNA ORF Clone, Mouse, C-HA tag MG53773-CY
MRPS18B cDNA ORF Clone, Mouse, N-HA tag MG53773-NY
MRPS18B cDNA ORF Clone, Mouse, C-Myc tag MG53773-CM
MRPS18B cDNA ORF Clone, Mouse, N-Myc tag MG53773-NM

MRPS18B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPS18B cDNA ORF Clone in Cloning Vector, Human HG16243-G
MRPS18B cDNA ORF Clone, Human, C-GFPSpark® tag HG16243-ACG
MRPS18B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16243-ACGLN
MRPS18B cDNA ORF Clone, Human, N-GFPSpark® tag HG16243-ANG
MRPS18B cDNA ORF Clone, Human, C-OFPSpark® tag HG16243-ACR
MRPS18B cDNA ORF Clone, Human, N-OFPSpark® tag HG16243-ANR
MRPS18B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16243-CF
MRPS18B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16243-NF
MRPS18B cDNA ORF Clone, Human, C-His tag HG16243-CH
MRPS18B cDNA ORF Clone, Human, N-His tag HG16243-NH
MRPS18B cDNA ORF Clone, Human, C-HA tag HG16243-CY
MRPS18B cDNA ORF Clone, Human, N-HA tag HG16243-NY
MRPS18B cDNA ORF Clone, Human, C-Myc tag HG16243-CM
MRPS18B cDNA ORF Clone, Human, N-Myc tag HG16243-NM
MRPS18B qPCR Primer Pairs, Human HP105007
info info
添加购物车成功! 添加购物车失败!