MRPL2 cDNA ORF Clone, Human, untagged

Cat: HG16176-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPL2 Reagents
CRO Services
Product recommended

All MRPL2 Reagents
MRPL2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
678 bp
Description
Full length Clone DNA of Human mitochondrial ribosomal protein L2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL2 cDNA ORF Clone, Human, untagged Alternative Names
CGI-22 cDNA ORF Clone, Human;MRP-L14 cDNA ORF Clone, Human;RPML14 cDNA ORF Clone, Human
MRPL2 Background Information
Full Name
mitochondrial ribosomal protein L2

MRPL2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPL2 cDNA ORF Clone in Cloning Vector, Rat RG8A1507-U
MRPL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1507-ACGLN

MRPL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL2 cDNA ORF Clone in Cloning Vector, Mouse MG53781-U
MRPL2 cDNA ORF Clone, Mouse, untagged MG53781-UT
MRPL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53781-ACG
MRPL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53781-ACGLN
MRPL2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53781-ANG
MRPL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53781-ACR
MRPL2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53781-ANR
MRPL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53781-CF
MRPL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53781-NF
MRPL2 cDNA ORF Clone, Mouse, C-His tag MG53781-CH
MRPL2 cDNA ORF Clone, Mouse, N-His tag MG53781-NH
MRPL2 cDNA ORF Clone, Mouse, C-HA tag MG53781-CY
MRPL2 cDNA ORF Clone, Mouse, N-HA tag MG53781-NY
MRPL2 cDNA ORF Clone, Mouse, C-Myc tag MG53781-CM
MRPL2 cDNA ORF Clone, Mouse, N-Myc tag MG53781-NM

MRPL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPL2 cDNA ORF Clone in Cloning Vector, Human HG16176-G
MRPL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16176-ACGLN
MRPL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16176-ACG
MRPL2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16176-ANG
MRPL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16176-ACR
MRPL2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16176-ANR
MRPL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16176-CF
MRPL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16176-NF
MRPL2 cDNA ORF Clone, Human, C-His tag HG16176-CH
MRPL2 cDNA ORF Clone, Human, N-His tag HG16176-NH
MRPL2 cDNA ORF Clone, Human, C-HA tag HG16176-CY
MRPL2 cDNA ORF Clone, Human, N-HA tag HG16176-NY
MRPL2 cDNA ORF Clone, Human, C-Myc tag HG16176-CM
MRPL2 cDNA ORF Clone, Human, N-Myc tag HG16176-NM
MRPL2 qPCR Primer Pairs, Human HP104945
info info
添加购物车成功! 添加购物车失败!