MRPL15 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16396-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPL15 Reagents
CRO Services
Product recommended

All MRPL15 Reagents
MRPL15 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
891 bp
Description
Full length Clone DNA of Human mitochondrial ribosomal protein L15 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL15 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HSPC145 cDNA ORF Clone, Human;L15mt cDNA ORF Clone, Human;MRP-L15 cDNA ORF Clone, Human;MRP-L7 cDNA ORF Clone, Human;RPML7 cDNA ORF Clone, Human
MRPL15 Background Information
Full Name
mitochondrial ribosomal protein L15

MRPL15 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPL15 cDNA ORF Clone in Cloning Vector, Rat RG8A4373-U
MRPL15 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4373-ACGLN

MRPL15 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL15 cDNA ORF Clone in Cloning Vector, Mouse MG53728-U
MRPL15 cDNA ORF Clone, Mouse, untagged MG53728-UT
MRPL15 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53728-ACGLN
MRPL15 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53728-ACG
MRPL15 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53728-ANG
MRPL15 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53728-ACR
MRPL15 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53728-ANR
MRPL15 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53728-CF
MRPL15 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53728-NF
MRPL15 cDNA ORF Clone, Mouse, C-His tag MG53728-CH
MRPL15 cDNA ORF Clone, Mouse, N-His tag MG53728-NH
MRPL15 cDNA ORF Clone, Mouse, C-HA tag MG53728-CY
MRPL15 cDNA ORF Clone, Mouse, N-HA tag MG53728-NY
MRPL15 cDNA ORF Clone, Mouse, C-Myc tag MG53728-CM
MRPL15 cDNA ORF Clone, Mouse, N-Myc tag MG53728-NM

MRPL15 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPL15 cDNA ORF Clone in Cloning Vector, Human HG16396-G
MRPL15 cDNA ORF Clone, Human, untagged HG16396-UT
MRPL15 cDNA ORF Clone, Human, C-GFPSpark® tag HG16396-ACG
MRPL15 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16396-ACGLN
MRPL15 cDNA ORF Clone, Human, N-GFPSpark® tag HG16396-ANG
MRPL15 cDNA ORF Clone, Human, C-OFPSpark® tag HG16396-ACR
MRPL15 cDNA ORF Clone, Human, N-OFPSpark® tag HG16396-ANR
MRPL15 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16396-NF
MRPL15 cDNA ORF Clone, Human, C-His tag HG16396-CH
MRPL15 cDNA ORF Clone, Human, N-His tag HG16396-NH
MRPL15 cDNA ORF Clone, Human, C-HA tag HG16396-CY
MRPL15 cDNA ORF Clone, Human, N-HA tag HG16396-NY
MRPL15 cDNA ORF Clone, Human, C-Myc tag HG16396-CM
MRPL15 cDNA ORF Clone, Human, N-Myc tag HG16396-NM
MRPL15 qPCR Primer Pairs, Human HP105145
info info
添加购物车成功! 添加购物车失败!