MRAP cDNA ORF Clone, Human, untagged

Cat: HG15444-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRAP Reagents
CRO Services
Product recommended

All MRAP Reagents
MRAP cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
519 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human melanocortin 2 receptor accessory protein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+0.52kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MRAP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRAP cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
MRAP cDNA ORF Clone, Human, untagged Alternative Names
B27 cDNA ORF Clone, Human;C21orf61 cDNA ORF Clone, Human;FALP cDNA ORF Clone, Human;FGD2 cDNA ORF Clone, Human;GCCD2 cDNA ORF Clone, Human
MRAP Background Information
Full Name
melanocortin 2 receptor accessory protein

MRAP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRAP cDNA ORF Clone in Cloning Vector, Rat RG80734-U
MRAP cDNA ORF Clone, Rat, untagged RG80734-UT
MRAP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80734-ACG
MRAP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80734-ACGLN
MRAP cDNA ORF Clone, Rat, N-GFPSpark® tag RG80734-ANG
MRAP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80734-ACR
MRAP cDNA ORF Clone, Rat, N-OFPSpark® tag RG80734-ANR
MRAP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80734-CF
MRAP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80734-NF
MRAP cDNA ORF Clone, Rat, C-His tag RG80734-CH
MRAP cDNA ORF Clone, Rat, N-His tag RG80734-NH
MRAP cDNA ORF Clone, Rat, C-HA tag RG80734-CY
MRAP cDNA ORF Clone, Rat, N-HA tag RG80734-NY
MRAP cDNA ORF Clone, Rat, C-Myc tag RG80734-CM
MRAP cDNA ORF Clone, Rat, N-Myc tag RG80734-NM
MRAP qPCR Primer Pairs, Rat RP300698

MRAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRAP cDNA ORF Clone in Cloning Vector, Human HG15444-G
MRAP cDNA ORF Clone, Human, C-GFPSpark® tag HG15444-ACG
MRAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15444-ACGLN
MRAP cDNA ORF Clone, Human, C-OFPSpark® tag HG15444-ACR
MRAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15444-CF
MRAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15444-NF
MRAP cDNA ORF Clone, Human, C-His tag HG15444-CH
MRAP cDNA ORF Clone, Human, N-His tag HG15444-NH
MRAP cDNA ORF Clone, Human, C-HA tag HG15444-CY
MRAP cDNA ORF Clone, Human, N-HA tag HG15444-NY
MRAP cDNA ORF Clone, Human, C-Myc tag HG15444-CM
MRAP cDNA ORF Clone, Human, N-Myc tag HG15444-NM
MRAP qPCR Primer Pairs, Human HP104068
info info
添加购物车成功! 添加购物车失败!