MPZL2 cDNA ORF Clone, Human, N-His tag

Cat: HG13789-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MPZL2 Reagents
CRO Services
Product recommended

All MPZL2 Reagents
MPZL2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Human myelin protein zero-like 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MPZL2 cDNA ORF Clone, Human, N-His tag Alternative Names
EVA cDNA ORF Clone, Human;EVA1 cDNA ORF Clone, Human
MPZL2 Background Information
Full Name
myelin protein zero-like 2

MPZL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MPZL2 cDNA ORF Clone in Cloning Vector, Mouse MG5A2091-U
MPZL2 cDNA ORF Clone, Mouse, untagged MG5A2091-UT
MPZL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2091-ACG
MPZL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2091-ACGLN
MPZL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2091-ACR
MPZL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2091-CF
MPZL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2091-NF
MPZL2 cDNA ORF Clone, Mouse, C-His tag MG5A2091-CH
MPZL2 cDNA ORF Clone, Mouse, N-His tag MG5A2091-NH
MPZL2 cDNA ORF Clone, Mouse, C-HA tag MG5A2091-CY
MPZL2 cDNA ORF Clone, Mouse, N-HA tag MG5A2091-NY
MPZL2 cDNA ORF Clone, Mouse, C-Myc tag MG5A2091-CM
MPZL2 cDNA ORF Clone, Mouse, N-Myc tag MG5A2091-NM

MPZL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MPZL2 cDNA ORF Clone in Cloning Vector, Human HG13789-G
MPZL2 cDNA ORF Clone, Human, untagged HG13789-UT
MPZL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13789-ACGLN
MPZL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13789-ACG
MPZL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13789-ACR
MPZL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13789-CF
MPZL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13789-NF
MPZL2 cDNA ORF Clone, Human, C-His tag HG13789-CH
MPZL2 cDNA ORF Clone, Human, C-HA tag HG13789-CY
MPZL2 cDNA ORF Clone, Human, N-HA tag HG13789-NY
MPZL2 cDNA ORF Clone, Human, C-Myc tag HG13789-CM
MPZL2 cDNA ORF Clone, Human, N-Myc tag HG13789-NM
MPZL2 qPCR Primer Pairs, Human HP102463
info info
添加购物车成功! 添加购物车失败!