Quick Order

Text Size:AAA

Human MMP-8 / MMP8 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human MMP8 cDNA Clone Product Information
NCBI RefSeq:NM_002424.2
RefSeq ORF Size:1404bp
cDNA Description:Full length Clone DNA of Homo sapiens matrix metallopeptidase 8 (neutrophil collagenase) with N terminal His tag.
Gene Synonym:MMP8, HNC, CLG1, PMNL-CL
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-MMP8
Restriction Site:KpnI + XbaI (6kb + 1.44kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MMP8 Gene Plasmid Map
Human MMP-8 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Neutrophil collagenase, also known as Matrix metalloproteinase-8, MMP-8, and CLG1, is a member of the peptidase M10A family. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 in the tumour may have a protective effect against lymph node metastasis. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 participates in wound repair by contributing to the resolution of inflammation and open the possibility to develop new strategies for treating wound healing defects.

Size / Price
Catalog: HG10254-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human MMP-8 natural ORF mammalian expression plasmid, N-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"