MMP-2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10082-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MMP-2 Reagents
CRO Services
Product recommended

All MMP-2 Reagents
MMP-2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1983 bp
Description
Full length Clone DNA of Human matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V collagenase), transcript variant 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP-2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CLG4 cDNA ORF Clone, Human;CLG4A cDNA ORF Clone, Human;MMP-2 cDNA ORF Clone, Human;MMP-II cDNA ORF Clone, Human;MONA cDNA ORF Clone, Human;TBE-1 cDNA ORF Clone, Human
MMP-2 Background Information

Matrix Metalloproteinase-2 (MMP-2) is an enzyme that degrades components of the extracellular matrix and thus plays a pivotal role in cell migration during physiological and pathological processes. MMP-2 expression is dependent on extracellular matrix metalloproteinase inducer (EMMPRIN), Her2/neu, growth factors, cytokines, and hormones. Pro-MMP-2 activation needs MT1-MMP and TIMP-2 contribution. MMP-2 is changed in distribution and increased in amount in the ventral cochlear nucleus after unilateral cochlear ablation. A low level of MMP-2 is linked to favorable prognosis in patients with a hormone receptor-negative tumor, usually associated with high risk. As a zymogen requiring proteolytic activation for catalytic activity, MMP-2 has been implicated broadly in the invasion and metastasis of many cancer model systems, including human breast cancer (HBC). Blocking MMP-2 secretion and activation during breast carcinoma development may decrease metastasis. The detection of active MMP-2 alone or the rate of pro-MMP-2 and active MMP-2 is considered a very sensitive indicator of cancer metastasis. Modulation of MMP-2 expression and activation through specific inhibitors and activators may thus provide a new mechanism for breast cancer treatment.

Full Name
matrix metallopeptidase 2
References
  • Thompson EW, et al. (1994) Collagen induced MMP-2 activation in human breast cancer. Breast Cancer Res Treat. 31(2-3): 357-70.
  • Jezierska A, et al. (2009) Matrix metalloproteinase-2 involvement in breast cancer progression: a mini-review. Med Sci Monit. 15(2): RA32-40.
  • Fredrich M, et al. (2010) MMP-2 is involved in synaptic remodeling after cochlear lesion. Neuroreport. 21(5): 324-7.
  • info info
    添加购物车成功! 添加购物车失败!