MMP-14/MMP14 cDNA ORF Clone, Human, untagged

Cat: HG10741-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MMP-14/MMP14 Reagents
CRO Services
Product recommended

All MMP-14/MMP14 Reagents
MMP-14/MMP14 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1749 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human matrix metallopeptidase 14 (membrane-inserted).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII + XbaI (6.1kb + 1.75kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MMP-14/MMP14 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP-14/MMP14 cDNA ORF Clone, Human, untagged Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624
MMP-14/MMP14 cDNA ORF Clone, Human, untagged Alternative Names
MMP-14 cDNA ORF Clone, Human;MMP-X1 cDNA ORF Clone, Human;MT-MMP cDNA ORF Clone, Human;MT-MMP1 cDNA ORF Clone, Human;MT1-MMP cDNA ORF Clone, Human;MT1MMP cDNA ORF Clone, Human;MTMMP1 cDNA ORF Clone, Human;WNCHRS cDNA ORF Clone, Human
MMP-14/MMP14 Background Information
Full Name
matrix metallopeptidase 14

MMP-14/MMP14 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MMP-14/MMP14 cDNA ORF Clone in Cloning Vector, Rat RG82063-U
MMP-14/MMP14 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82063-ACGLN

MMP-14/MMP14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MMP-14/MMP14 cDNA ORF Clone in Cloning Vector, Mouse MG51026-G
MMP-14/MMP14 cDNA ORF Clone, Mouse, untagged MG51026-UT
MMP-14/MMP14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51026-ACGLN
MMP-14/MMP14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51026-ACG
MMP-14/MMP14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51026-ACR
MMP-14/MMP14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51026-CF
MMP-14/MMP14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51026-NF
MMP-14/MMP14 cDNA ORF Clone, Mouse, C-His tag MG51026-CH
MMP-14/MMP14 cDNA ORF Clone, Mouse, N-His tag MG51026-NH
MMP-14/MMP14 cDNA ORF Clone, Mouse, C-HA tag MG51026-CY
MMP-14/MMP14 cDNA ORF Clone, Mouse, N-HA tag MG51026-NY
MMP-14/MMP14 cDNA ORF Clone, Mouse, C-Myc tag MG51026-CM
MMP-14/MMP14 cDNA ORF Clone, Mouse, N-Myc tag MG51026-NM
MMP-14/MMP14 qPCR Primer Pairs, Mouse MP200985

MMP-14/MMP14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MMP-14/MMP14 cDNA ORF Clone in Cloning Vector, Human HG10741-M
MMP-14/MMP14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10741-ACGLN
MMP-14/MMP14 cDNA ORF Clone, Human, C-GFPSpark® tag HG10741-ACG
MMP-14/MMP14 cDNA ORF Clone, Human, C-OFPSpark® tag HG10741-ACR
MMP-14/MMP14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10741-CF
MMP-14/MMP14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10741-NF
MMP-14/MMP14 cDNA ORF Clone, Human, C-His tag HG10741-CH
MMP-14/MMP14 cDNA ORF Clone, Human, N-His tag HG10741-NH
MMP-14/MMP14 cDNA ORF Clone, Human, C-HA tag HG10741-CY
MMP-14/MMP14 cDNA ORF Clone, Human, N-HA tag HG10741-NY
MMP-14/MMP14 cDNA ORF Clone, Human, C-Myc tag HG10741-CM
MMP-14/MMP14 cDNA ORF Clone, Human, N-Myc tag HG10741-NM
MMP-14/MMP14 qPCR Primer Pairs, Human HP100895
info info
添加购物车成功! 添加购物车失败!