Quick Order

Human MMP-12/MMP12 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human MMP12 cDNA Clone Product Information
    NCBI RefSeq:NM_002426.4
    RefSeq ORF Size:1413bp
    cDNA Description:Full length Clone DNA of Homo sapiens matrix metallopeptidase 12 (macrophage elastase) with N terminal Myc tag.
    Gene Synonym:MMP12, HME, MME, MGC138506
    Species:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MMP12 qPCR primers for gene expression analysis, HP100314 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Macrophage metalloelastase, also known as Matrix metalloproteinase-12, Macrophage elastase, MMP12, and MMP-12, is a secreted protein which belongs to the peptidase M10A family. MMP12 is a macrophage-secreted elastase that is highly induced in the liver and lung in response to S. mansoni eggs and contains four hemopexin-like domains. MMP12 is a proteolytic enzyme responsible for cleavage of plasminogen to angiotensin, which has an angiostatic effect. It may be involved in tissue injury and remodeling and has significant elastolytic activity. It may be related to prognosis in breast cancer patients. MMP12 promotes fibrosis by limiting the expression of specific ECM-degrading MMPs. Like MMP12, MMP13 expression is highly dependent on IL-13 and type I I-IL-4 receptor signaling. MMP12 is a potent proinflammatory and oncogenic molecule. MMP12 up-regulation plays a critical role in emphysema to lung cancer transition that is facilitated by inflammation.

    Size / Price
    Catalog: HG10266-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"