MMP1 cDNA ORF Clone, Human, C-HA tag

Cat: HG10532-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MMP1 Reagents
CRO Services
Product recommended

All MMP1 Reagents
MMP1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1452 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 648A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human matrix metallopeptidase 1 (interstitial collagenase) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + NotI(6kb+1.45kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MMP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP1 cDNA ORF Clone, Human, C-HA tag Validated Images
Rhesus TLR4 / TLR-4 Gene Plasmid Map 5626
MMP1 cDNA ORF Clone, Human, C-HA tag Alternative Names
CLG cDNA ORF Clone, Human;CLGN cDNA ORF Clone, Human
MMP1 Background Information

MMP1, also known as MMP-1, contains 4 hemopexin-like domains and is a member of the matrix metalloproteinase (MMP) family. Matrix metalloproteases, also called matrixins, are zinc-dependent endopeptidases that are the major proteases involved in ECM degradation. MMPs are capable of degrading a wide range of extracellular molecules and a number of bioactive molecules. MMP activity is regulated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMPs play a central role in cell proliferation, migration, differentiation, angiogenesis, apoptosis and host defences. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Tumour metastasis is a multistep process involving the dessemination of tumor cells from the primary tumor to secondarys at a distant organ or tissue. One of the first steps in metastasis is the degradation of the basement membrane, a process in which MMPs have been implicated. MMPs are secreted by tumor cells themselves or by surrounding stromal cells stimulated by the nearby tumor. Numerous studies have linked altered MMP expression in different human cancers with poor disease prognosis. MMP-1, -2, -3, -7, -9, -13 and -14 all have elevated expression in primary tumors and/or metastases. MMP-1 cleaves collagens of types I, II, and III at one site in the helical domain. It also cleaves collagens of types VII and X. In case of HIV infection, MMP1 interacts and cleaves the secreted viral Tat protein, leading to a decrease in neuronal Tat's mediated neurotoxicity.

Full Name
matrix metallopeptidase 1
References
  • Gross J, et al. (1962) Collagenolytic Activity in Amphibian Tissues: A Tissue Culture Assay. Proceedings of the National Academy of Sciences. 48(6):1014-22.
  • Pendas, et al. (1996) Fine Physical Mapping of the Human Matrix Metalloproteinase Genes Clustered on Chromosome 11q22.3. Genomics. 37(2):266-8.
  • Brinckerhoff C E, et al. (1987) Molecular cloning of human synovial cell collagenase and selection of a single gene from genomic DNA. Journal of Clinical Investigation. 79(2):542-6.
  • info info
    添加购物车成功! 添加购物车失败!