Quick Order

Human MLH1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human MLH1 cDNA Clone Product Information
NCBI RefSeq:NM_000249
RefSeq ORF Size:2271bp
cDNA Description:Full length Clone DNA of Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) with C terminal His tag.
Gene Synonym:COCA2,FCC2,hMLH1,HNPCC,HNPCC, FCC2, HNPCC2,HNPCC2
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-MLH1-His
Restriction Site:KpnI+XbaI (6kb+2.32kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MLH1 qPCR primers for gene expression analysis, HP101575 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MLH1 Gene Plasmid Map
Human MLH1 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG12041-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
  • Human MLH1 ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"