Ki67 cDNA ORF Clone, Human, N-His tag

Cat: HG13180-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ki67 Reagents
CRO Services

All Ki67 Reagents
Ki67 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
819 bp
Description
Full length Clone DNA of Human antigen identified by monoclonal antibody Ki-67 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ki67 cDNA ORF Clone, Human, N-His tag Alternative Names
KIA cDNA ORF Clone, Human;MIB- cDNA ORF Clone, Human;MIB-1 cDNA ORF Clone, Human;PPP1R105 cDNA ORF Clone, Human
Ki67 Background Information

MKI67 contains 1 FHA domain and plays a key role in cell proliferation. During interphase, the MKI67 antigen can be exclusively detected within the cell nucleus, whereas in mitosis most of the protein is relocated to the surface of the chromosomes. MKI67 protein is present during all active phases of the cell cycle (G1, S, G2, and mitosis), but is absent from resting cells. MKI67 is an excellent marker to determine the growth fraction of a given cell population. The fraction of MKI67-positive tumor cells is often correlated with the clinical course of cancer. It is also associated with ribosomal RNA transcription. Inactivation of antigen MKI67 leads to inhibition of ribosomal RNA synthesis.

The MKI67 protein is a nuclear and nucleolar protein, which is tightly associated with somatic cell proliferation. Antibodies raised against the human MKI67 protein paved the way for the immunohistological assessment of cell proliferation, particularly useful in numerous studies on the prognostic value of cell growth in clinical samples of human neoplasms. MKI67 protein expression is an absolute requirement for progression through the cell-division cycle. Recently, MKI67 is proved be an independent prognostic factor for disease-free survival (HR 1.05-1.72) in multivariate analyses studies using samples from randomized clinical trials with secondary central analysis of the biomarker. MKI67 was not found to be predictive for long-term follow-up after chemotherapy. Nevertheless, high KI-67 was found to be associated with immediate pathological complete response in the neoadjuvant setting, with an LOE of II-B. MKI67 could be considered as a prognostic biomarker for therapeutic decision.

Full Name
marker of proliferation Ki-67
References
  • Rahmanzadeh R, et al. (2007) Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis. Cell Prolif. 40(3):422-30.
  • Bullwinkel J, et al. (2006) Ki-67 protein is associated with ribosomal RNA transcription in quiescent and proliferating cells. J Cell Physiol. 206(3):624-35.
  • Schonk DM, et al. (1989) Assignment of the gene(s) involved in the expression of the proliferation-related Ki-67 antigen to human chromosome 10. Hum Genet. 83(3):297-9.
  • Endl E, et al., 2000, Exp Cell Res. Jun 15;257(2): 231-7.
  • Luporsi E, et al., 2012, Breast Cancer Res Treat. 132(3): 895-915.
  • Scholzen T, et al., 2000, J Cell Physiol. 182(3): 311-22.
  • Ki67 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ki67 qPCR Primer Pairs, Human HP101766
    info info
    添加购物车成功! 添加购物车失败!